View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0875_low_44 (Length: 321)
Name: NF0875_low_44
Description: NF0875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0875_low_44 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 99 - 222
Target Start/End: Complemental strand, 40085116 - 40084993
Alignment:
| Q |
99 |
tgggttcattaccggggttaaccaatctcattctctgtcacaaccgtttaaccggttcacttccccggtttgattctcaaagcttaagccggttggacct |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40085116 |
tgggttcattaccggggttaaccaatctcattctctgtcacaaccgtttaaccggttcacttccccggtttgattctcaaagcttaagccggttggacct |
40085017 |
T |
|
| Q |
199 |
aaagcacaactctctcacaggttc |
222 |
Q |
| |
|
|||||||||||||||||| ||||| |
|
|
| T |
40085016 |
aaagcacaactctctcaccggttc |
40084993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 89; Significance: 7e-43; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 229 - 321
Target Start/End: Complemental strand, 8773820 - 8773728
Alignment:
| Q |
229 |
ttcactgaaaagattgttgctttcttctttcctctaatgtttctgttagccttgttgggttgatgtggttcacaacactgctacaattctgct |
321 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8773820 |
ttcacagaaaagattgttgctttcttctttcctctaatgtttctgttagccttgttgggttgatgtggttcacaacactgctacaattctgct |
8773728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 261 - 306
Target Start/End: Original strand, 48597617 - 48597662
Alignment:
| Q |
261 |
tctaatgtttctgttagccttgttgggttgatgtggttcacaacac |
306 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| | ||||||||| |
|
|
| T |
48597617 |
tctaatgtttcagttagccttgttgggttgatgtcgatcacaacac |
48597662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2348 times since January 2019
Visitors: 6162