View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0875_low_58 (Length: 281)
Name: NF0875_low_58
Description: NF0875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0875_low_58 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 8 - 253
Target Start/End: Complemental strand, 46892706 - 46892461
Alignment:
| Q |
8 |
tgagatgaaaatcaagaaaaagagccaaaagagaagcattaaaaacagcattgaaacaccaagccttcatcccagagcatccaccaccatcggatccgaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
46892706 |
tgagatgaaaatcaagaaaaagagccaaaagagaagcattaaaaacagcattgaaacaccaagccttcatcccacagcatccaccaccatcggatccgaa |
46892607 |
T |
|
| Q |
108 |
gtgataataaagcatgagaccggagacggcgaagctgaacacgaactgaacaatctggcagtcggtaacgacgcgtttccaaggcggtcggataccaacg |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
46892606 |
gtgataataaagcatgagaccggagacggcgaagctgaacacgaactgaacaatctggcagtcggtaacgacgcgtttccaaggcggtcggattccaacg |
46892507 |
T |
|
| Q |
208 |
gtggtgaggaagtagtaagagtacatgatgacgtggacggatgagt |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46892506 |
gtggtgaggaagtagtaagagtacatgatgacgtggacggatgagt |
46892461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1554 times since January 2019
Visitors: 6145