View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0875_low_59 (Length: 280)
Name: NF0875_low_59
Description: NF0875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0875_low_59 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 154; Significance: 1e-81; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 59 - 236
Target Start/End: Complemental strand, 31542871 - 31542694
Alignment:
Q |
59 |
aattacaactggcaatcctttgcttgggaaaaatatttcccaacaattagatggaggagaaaacacaactgcttctcgtgatggaggctcatctaagaca |
158 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31542871 |
aattacaactggcaatcctttgcttgggaaaaatatttcccaacaattaggtggaggagaaaacacaactgcttctcgtgatggaggctcatctaagaca |
31542772 |
T |
 |
Q |
159 |
acaattgcacctgcctggatttttggtatgtatacatacccaataatatatatattttaatatattgtcttctttcat |
236 |
Q |
|
|
|||||||||||||| |||||| |||||||||||||||||| | || |||||||||||||||||||||||||||||||| |
|
|
T |
31542771 |
acaattgcacctgcttggattgttggtatgtatacataccgattattatatatattttaatatattgtcttctttcat |
31542694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 949 times since January 2019
Visitors: 6134