View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0875_low_63 (Length: 265)
Name: NF0875_low_63
Description: NF0875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0875_low_63 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 68 - 265
Target Start/End: Complemental strand, 690731 - 690531
Alignment:
| Q |
68 |
gaaatcaagtgaaacttagatattgaatcttctttaagacgagaaggtgaaggatgaacgggtaggaaattcttccacgttccaatattttactgcgc-n |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
690731 |
gaaatcaagtgaaacttagatattgaatcttctttaagaggagaaggtgaaggatgaacgggtaggaaattcttccacgttccaatattttactgcgctt |
690632 |
T |
 |
| Q |
167 |
nnnnnnnctcgttatttttcaacaaaatgagtttgcattctgacaagttttagcactc--ttttgaattttgatcatgttacgcagactaaattccgaac |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
690631 |
tttttttctcgttatttttcaacaaaatgagtttgcattctgacaagttttagcactcttttttgaattttgatcatgttacgcagactaaattctgaac |
690532 |
T |
 |
| Q |
265 |
t |
265 |
Q |
| |
|
| |
|
|
| T |
690531 |
t |
690531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University