View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0875_low_65 (Length: 262)
Name: NF0875_low_65
Description: NF0875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0875_low_65 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 66 - 247
Target Start/End: Complemental strand, 2857225 - 2857047
Alignment:
Q |
66 |
tttcgcaagagacatggatctggtcctttcactcatggcaaaccagnnnnnnnnnnnnngctagatagagagagtatcattagaggcatataaatannnn |
165 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
2857225 |
tttcgcaagagacatggatctgttcctttcactcatggcaaaccagttttttttttt--gctagatagagagagtatcattagaggcatataaatatttt |
2857128 |
T |
 |
Q |
166 |
nnnnnnnnnctttgtcaaccttaaagttgtgattcttcttaaattcttagatattcataaatgatacgatcgtatgcacact |
247 |
Q |
|
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
2857127 |
ttcatttttctttgtctgccttaaagttgtgattcttcttaaattcttagatattcataaatgata-gatcgtatgcacact |
2857047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 37 - 67
Target Start/End: Complemental strand, 2857313 - 2857283
Alignment:
Q |
37 |
caagtatcataaaaatattgtttaagaaatt |
67 |
Q |
|
|
||||||||||||||||||||||||||||||| |
|
|
T |
2857313 |
caagtatcataaaaatattgtttaagaaatt |
2857283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1657 times since January 2019
Visitors: 6148