View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0875_low_67 (Length: 259)
Name: NF0875_low_67
Description: NF0875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0875_low_67 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 16 - 250
Target Start/End: Original strand, 978660 - 978893
Alignment:
Q |
16 |
cttgattgttggcttgttcttcattggaggttgaaccaggttcttgattgtttccaaaggtgaagtatggtatctcaattctctgaatcttttgaggtct |
115 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
978660 |
cttgattgttggcttgttctccattggaggttgaaccaggttcttgcttgtttccaaaggtgaagtatggtatctcaattctctgaatcttttgaggtct |
978759 |
T |
 |
Q |
116 |
ttgtatattattgtttctgggatccaattgatcaggactggagacattgctgannnnnnnnncctttatttgtttccatggtaccaatttcagagagaag |
215 |
Q |
|
|
|||||||||||||||||||||||||||||||| |||| ||||||||||||||| |||||||||| ||||||||||||||||||||||||||| |
|
|
T |
978760 |
ttgtatattattgtttctgggatccaattgattaggattggagacattgctga-tttcttttcctttatttgcttccatggtaccaatttcagagagaag |
978858 |
T |
 |
Q |
216 |
aatatagagaaagatgaaatctagaagaaaccaag |
250 |
Q |
|
|
|||||||||||| |||||||||||||||||||||| |
|
|
T |
978859 |
aatatagagaaaaatgaaatctagaagaaaccaag |
978893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University