View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0875_low_68 (Length: 255)
Name: NF0875_low_68
Description: NF0875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0875_low_68 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 16 - 213
Target Start/End: Original strand, 45122113 - 45122310
Alignment:
| Q |
16 |
atgaacttgattcaatgtccaacatttcagctttaccaagcctatcccacaaactaatttcagtttgctcgggaagctgatcaatttttgcatcctctgc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45122113 |
atgaacttgattcaatgtccaacatttcagctttaccaagcctgtcccacaaactaatttcagtttgctcgggaagctgatcaatttttgcatcctctgc |
45122212 |
T |
|
| Q |
116 |
agattctctaagactaaaaataatttaaatcagttatcaacaactttagaaagcatattgaatccatgacaaaacattatgacatctcttgttacagc |
213 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45122213 |
agattctctaagactataaataatttaaatcagttatcaacaactttagaaagcatattgaatccatgacaaaacattatgacatctcttgttacagc |
45122310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 21 - 76
Target Start/End: Original strand, 40258211 - 40258266
Alignment:
| Q |
21 |
cttgattcaatgtccaacatttcagctttaccaagcctatcccacaaactaatttc |
76 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
40258211 |
cttgattcaacatccaacatttcagctttaccaagcctctcccacaagctaatttc |
40258266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 971 times since January 2019
Visitors: 6135