View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0875_low_71 (Length: 252)
Name: NF0875_low_71
Description: NF0875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0875_low_71 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 9 - 252
Target Start/End: Complemental strand, 49182372 - 49182129
Alignment:
| Q |
9 |
agcagagaaaatgttgagaaagctaaagagcaactatgtacattttcatattgcggctggttaggggtcactgtgattctggtaaactcattgtgatgtc |
108 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
49182372 |
agcagagaagatgttgagaaagctaaagagcaactatgtacattttcatattgcggctggttagaggtcactgtgattctggtaaactcattgtgatgtc |
49182273 |
T |
 |
| Q |
109 |
aaacaaaggcaaaactatgattgtttgtggcgtgggagttttggctatcccaannnnnnnnatttgaataatttagtatattgtgtaattagctacctca |
208 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49182272 |
aaacaaaggcaaaactatgattgtctgtggcgtggtagttttggctatcccaattttttttatttgaataatttagtatattgtgtaattagctacctca |
49182173 |
T |
 |
| Q |
209 |
acaatgtatatttagcttatacaaatcagcttatttgtcgaaaa |
252 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
49182172 |
acaatgtatatttagcttatacaaatgagcttatttgtcgaaaa |
49182129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University