View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0875_low_72 (Length: 252)
Name: NF0875_low_72
Description: NF0875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0875_low_72 |
 |  |
|
[»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 9 - 252
Target Start/End: Complemental strand, 49182372 - 49182129
Alignment:
Q |
9 |
agcagagaaaatgttgagaaagctaaagagcaactatgtacattttcatattgcggctggttaggggtcactgtgattctggtaaactcattgtgatgtc |
108 |
Q |
|
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
49182372 |
agcagagaagatgttgagaaagctaaagagcaactatgtacattttcatattgcggctggttagaggtcactgtgattctggtaaactcattgtgatgtc |
49182273 |
T |
 |
Q |
109 |
aaacaaaggcaaaactatgattgtttgtggcgtggtagttttggctatcccaannnnnnnnatttgaataatttagtatattgtgtaattagctacctca |
208 |
Q |
|
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
49182272 |
aaacaaaggcaaaactatgattgtctgtggcgtggtagttttggctatcccaattttttttatttgaataatttagtatattgtgtaattagctacctca |
49182173 |
T |
 |
Q |
209 |
acaatgtatatttagcttatacaaatcagcttatttgtcgaaaa |
252 |
Q |
|
|
|||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
49182172 |
acaatgtatatttagcttatacaaatgagcttatttgtcgaaaa |
49182129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1293 times since January 2019
Visitors: 6138