View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0875_low_74 (Length: 251)
Name: NF0875_low_74
Description: NF0875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0875_low_74 |
 | |
|
| [»] scaffold0082 (2 HSPs) |
| | |
|
| [»] scaffold0024 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0082 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: scaffold0082
Description:
Target: scaffold0082; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 41 - 240
Target Start/End: Complemental strand, 57424 - 57225
Alignment:
| Q |
41 |
cccatgctgagtcacaggcagcgcctcggaaagcgtggacgagccacatgcagggaaacttgcacgtgtggttctggccggggaccccggtatactgtac |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
57424 |
cccatgctgagtcacaggcagcgcctcggaaagcgcggacgagccacatgcagggaaacttgcacgtgtggttctggccggggaccccggtatactgtac |
57325 |
T |
|
| Q |
141 |
taatatgtgtaggtccccgtaattcgagtgagattgtcatggcgcaaaagcatatatggtccggtattcccttgttccctgtattggttatgttcttcat |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
57324 |
taatatgtgtaggtccccgtaattcgagtgagattgtcatggcgcaaaagcagatatggtccggtattcccttgttccctgtattggttatgttcttcat |
57225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0082; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 90 - 119
Target Start/End: Original strand, 5053 - 5082
Alignment:
| Q |
90 |
gcagggaaacttgcacgtgtggttctggcc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
5053 |
gcagggaaacttgcacgtgtggttctggcc |
5082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 41 - 240
Target Start/End: Original strand, 53675 - 53874
Alignment:
| Q |
41 |
cccatgctgagtcacaggcagcgcctcggaaagcgtggacgagccacatgcagggaaacttgcacgtgtggttctggccggggaccccggtatactgtac |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53675 |
cccatgctgagtcacaggcagcgcctcggaaagcgcggacgagccacatgaagggaaacttgcacgtgtggttctggccggggaccccggtatactgtac |
53774 |
T |
|
| Q |
141 |
taatatgtgtaggtccccgtaattcgagtgagattgtcatggcgcaaaagcatatatggtccggtattcccttgttccctgtattggttatgttcttcat |
240 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
53775 |
taatatgtgcaggtcctcgtaattcgagtgagattgtcatggcgcaaaatcagatatggtccggtattcccttgttcactgtattggttatgttcttcat |
53874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 79 - 164
Target Start/End: Complemental strand, 25283919 - 25283834
Alignment:
| Q |
79 |
acgagccacatgcagggaaacttgcacgtgtggttctggccggggaccccggtatactgtactaatatgtgtaggtccccgtaatt |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
25283919 |
acgagccacatgcagggaaacttgcacgtgtggttctggccggggaccccgttatactgtactaatatgtgtaggttcccgtaatt |
25283834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 179 - 240
Target Start/End: Complemental strand, 17660174 - 17660113
Alignment:
| Q |
179 |
atggcgcaaaagcatatatggtccggtattcccttgttccctgtattggttatgttcttcat |
240 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17660174 |
atggcgcaaaagcagatatggtccggtattcccttgttccctgtattggttatgttcttcat |
17660113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 77 - 122
Target Start/End: Original strand, 17870411 - 17870456
Alignment:
| Q |
77 |
ggacgagccacatgcagggaaacttgcacgtgtggttctggccggg |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17870411 |
ggacgagccacatgcagggaaacttgcacgtgtggttctggccggg |
17870456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 790 times since January 2019
Visitors: 6131