View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0875_low_79 (Length: 247)
Name: NF0875_low_79
Description: NF0875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0875_low_79 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-113; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 2677928 - 2678145
Alignment:
| Q |
1 |
tttgatcataaagaatttgctgagttagtgatttgccaaggaaagaacatcacatttagaagtgggatttggaatggcgttcgttttaattccgatgatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2677928 |
tttgatcataaagaatttgctgagttagtgattcaccaaggaaagaacatcacgtttagaagtgggatttggaatggcgttcgttttaattccgatgatt |
2678027 |
T |
 |
| Q |
101 |
ggacatcgtttataggagttacagccttcaagccacaactttcagtaaccaagaatgaggtagtgtattgggatgaacctggagatagattgtcaaggtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2678028 |
ggacatcgtttataggagttacagccttcaagccacaactttcagtaaccaagaatgaggtagtgtattgggatgaacctggagatagattgtcaaggtt |
2678127 |
T |
 |
| Q |
201 |
tatgatgagggatgatgg |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
2678128 |
tatgatgagggatgatgg |
2678145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 64 - 218
Target Start/End: Complemental strand, 3052613 - 3052462
Alignment:
| Q |
64 |
gggatttggaatggcgttcgttttaattccgatgattggacatcgtttataggagttacagccttcaagccacaactttcagtaaccaagaatgaggtag |
163 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |||| |||| | ||| | | |||||||||||||||||||||||||||||||| |
|
|
| T |
3052613 |
gggatttggaatggcgtcgcttttaattccgatgattggacatcttttacaggaatg---gcccttaggccacaactttcagtaaccaagaatgaggtag |
3052517 |
T |
 |
| Q |
164 |
tgtattgggatgaacctggagatagattgtcaaggtttatgatgagggatgatgg |
218 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3052516 |
tgaattgggatgaacctggagatagattgtcaaggtttatgattagggatgatgg |
3052462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University