View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0875_low_81 (Length: 228)
Name: NF0875_low_81
Description: NF0875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0875_low_81 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 8177551 - 8177330
Alignment:
| Q |
1 |
cactagacccttttgcttgaagttgcacatgagaaaccaaaaactcactaccatgttgcaaaaactcatcattatgatcattcttcaaagatgtttttct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8177551 |
cactagacccttttgcttgaagttgcacatgagaaaccaaaaactcactaccatgttgcaaaaactcatcattatgatcattcttcaaagatgtttttct |
8177452 |
T |
|
| Q |
101 |
ctctttctgcaagagaacactaccaaaaccaagtttggaaaatgaatgatgatttgatattgagaacttctgcagagttgtggaacatggtttttgagga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8177451 |
ctctttctgcaagagaacactaccaaaaccaagtttggaaaatgaatgatgatttgatattgagaacttctgcagagttgtggaacatggtttttgagga |
8177352 |
T |
|
| Q |
201 |
aatggggtatcagggttgaaac |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
8177351 |
aatggggtatcagggttgaaac |
8177330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2459 times since January 2019
Visitors: 6164