View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0875_low_82 (Length: 227)
Name: NF0875_low_82
Description: NF0875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0875_low_82 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 124; Significance: 6e-64; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 1 - 135
Target Start/End: Original strand, 38822660 - 38822797
Alignment:
| Q |
1 |
ctctctatgccagattatacctttgtaggcgttggtatcaaagataaattggttaagttagagaagcagtgtgggattggatac---ataaatgcatttg |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
38822660 |
ctctctatgccagattatacctttgtaggcgttggtatcaaagataaattggttaagttagagaagcagtgtgggattggatacataataaatgcatttg |
38822759 |
T |
 |
| Q |
98 |
aacttggaccacttgctgctactgttatggatatgcct |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38822760 |
aacttggaccacttgctgctactgttatggatatgcct |
38822797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 8 - 118
Target Start/End: Original strand, 38831149 - 38831259
Alignment:
| Q |
8 |
tgccagattatacctttgtaggcgttggtatcaaagataaattggttaagttagagaagcagtgtgggattggatacataaatgcatttgaacttggacc |
107 |
Q |
| |
|
||||||||||||||||||| | |||||||| |||||| | |||| |||| | ||||| | | ||||||| ||| || |||||| | ||||||||||| |
|
|
| T |
38831149 |
tgccagattatacctttgtcagtgttggtattaaagatgatttggctaagcttaagaaggaatatgggattagatgcagaaatgctgtggaacttggacc |
38831248 |
T |
 |
| Q |
108 |
acttgctgcta |
118 |
Q |
| |
|
|||||||||| |
|
|
| T |
38831249 |
tcttgctgcta |
38831259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 22 - 126
Target Start/End: Original strand, 38814142 - 38814246
Alignment:
| Q |
22 |
tttgtaggcgttggtatcaaagataaattggttaagttagagaagcagtgtgggattggatacataaatgcatttgaacttggaccacttgctgctactg |
121 |
Q |
| |
|
||||| || ||||| |||||||| || |||| |||||| |||||||||| ||| |||||| | |||||| ||||||||||||| ||||||| | || |
|
|
| T |
38814142 |
tttgttggagttggaatcaaagagaatttggctaagttggagaagcagtatggatttggatgtagaaatgctgttgaacttggaccctttgctgcaagtg |
38814241 |
T |
 |
| Q |
122 |
ttatg |
126 |
Q |
| |
|
||||| |
|
|
| T |
38814242 |
ttatg |
38814246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University