View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0875_low_83 (Length: 219)
Name: NF0875_low_83
Description: NF0875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0875_low_83 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 11 - 195
Target Start/End: Original strand, 47196661 - 47196845
Alignment:
| Q |
11 |
catcatcaaataacagttcgtgttgatctctaagtttggcatataggaaaaataaacagaaacaaaaaatagtacagagagaaggaaatgaactaatttt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47196661 |
catcatcaaataacagttcgtgttgatctctaagtttggcatataggaaaaataaacagaaacaaaaaatagtacagagagaaggaaatgaactaatttt |
47196760 |
T |
 |
| Q |
111 |
gattattacgtacaaaaacttagtaaaatttagactgaaatattatccacaaaactaaccaacactctataaagtatagagaagg |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47196761 |
gattattacgtacaaaaacttagtaaaatttagattgaaatattatccacaaaactaaccaacactctataaagtatagagaagg |
47196845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University