View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0875_low_85 (Length: 204)
Name: NF0875_low_85
Description: NF0875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0875_low_85 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 60; Significance: 9e-26; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 46494581 - 46494522
Alignment:
Q |
1 |
aacaccatcattcatcatggtttcatccaacaaggtattattcttattcctcttcatctc |
60 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46494581 |
aacaccatcattcatcatggtttcatccaacaaggtattattcttattcctcttcatctc |
46494522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1859 times since January 2019
Visitors: 6150