View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0875_low_86 (Length: 203)

Name: NF0875_low_86
Description: NF0875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0875_low_86
NF0875_low_86
[»] chr1 (1 HSPs)
chr1 (1-38)||(46494557-46494594)


Alignment Details
Target: chr1 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 46494557 - 46494594
Alignment:
1 tgaaaccatgatgaatgatggtgtttgagctttggttt 38  Q
    ||||||||||||||||||||||||||||||||||||||    
46494557 tgaaaccatgatgaatgatggtgtttgagctttggttt 46494594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University