View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0876_high_10 (Length: 336)
Name: NF0876_high_10
Description: NF0876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0876_high_10 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 300; Significance: 1e-169; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 300; E-Value: 1e-169
Query Start/End: Original strand, 29 - 336
Target Start/End: Complemental strand, 40511454 - 40511147
Alignment:
| Q |
29 |
atgcatcgccgtaagagcatgaatcttcagtgtcggcagcgttgacgacggaggaatcaaagctaccggatgaatcttccatctgaacgacggaggagag |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40511454 |
atgcatcgccgtaagagcatgaatcttcagtgtcggcagcgttgacgacggaggaatcaaagctaccggatgaatcttccatctgaacgacggaggagag |
40511355 |
T |
|
| Q |
129 |
tggaagagaggaatcagcgttgagattgagatccaacattgtgaggtttgagtttgttacgattcagttatgaagatttggagggaaaaatatatataaa |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40511354 |
tggaagagaggaatcagcgttgagattgagatccaacattgtgaggtttgagtttgttacgattcagttatgaagatttggagggaaaaatatatataaa |
40511255 |
T |
|
| Q |
229 |
gcgagttttagttagttagaatgaaagagagagaaggatccaaaatgaaaatgcttcacttcattgttctcgtgaatgaactcagcttaattcctttgct |
328 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
40511254 |
gcgagttttagttagttagaatgaaagagagagaaggatccaaaatgaaaatgcttcacttcattgttctcgtgaatgaactcagcttaattccttttct |
40511155 |
T |
|
| Q |
329 |
actcctct |
336 |
Q |
| |
|
| |||||| |
|
|
| T |
40511154 |
attcctct |
40511147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2344 times since January 2019
Visitors: 6162