View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0876_high_19 (Length: 251)
Name: NF0876_high_19
Description: NF0876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0876_high_19 |
 |  |
|
[»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 119 - 251
Target Start/End: Complemental strand, 53834689 - 53834560
Alignment:
Q |
119 |
ccttagattatctcttcctacagttctgnnnnnnnnatatccatacacacattctagaattaagctcagatttctatacctaaagaatatgattaagttc |
218 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
53834689 |
ccttagattatctcttcctacagttctgttttttt-atatccatacaca--ttctagaattaagctcagatttctatacctaaagaatatgattaagttc |
53834593 |
T |
 |
Q |
219 |
ccttcattcagtgtacataatggtactaatgaa |
251 |
Q |
|
|
||||||||||||||||||||||||||||||||| |
|
|
T |
53834592 |
ccttcattcagtgtacataatggtactaatgaa |
53834560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 6 - 71
Target Start/End: Complemental strand, 53834802 - 53834737
Alignment:
Q |
6 |
gtcgaagaatatttaacaaggttagatcatcgctgccccaatgtggttatgggcatgtcttgtcca |
71 |
Q |
|
|
|||||| | |||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
53834802 |
gtcgaatattatttaacaaggttagatcatcgctgtcccaatgtggttatgggcatgtcttgtcca |
53834737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University