View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0876_high_8 (Length: 378)
Name: NF0876_high_8
Description: NF0876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0876_high_8 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 310; Significance: 1e-174; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 30 - 378
Target Start/End: Complemental strand, 36281981 - 36281635
Alignment:
| Q |
30 |
gatccatggaagaagaagaggaagaaagtggggtttttggtggggttttgaggatgtgggaaggtgaactttttgattgctttgatcatcgtcgcattgc |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
36281981 |
gatccatggaagaagaagaggaagaaagtggggtttttggtggggttttgaggatgtgggaaggtgaactttttgattgcttcgatcatcgtcgcattgc |
36281882 |
T |
|
| Q |
130 |
tctagaatccataatgtaagcaatttacattcatattttatacgttaagtgcatgtttgagattgcagtgagatcgtaaaaattatggtggtcaccacga |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |||||||| |
|
|
| T |
36281881 |
tctagaatccataatgtaagcaatttacattcatattttatacgttaagtgcatgtttgagattgcggtgagatcgtaaaaattctggtggccaccacga |
36281782 |
T |
|
| Q |
230 |
ttttaacaaaaactgcattttaaaacttcaaaaatcacggtgttgccgtaattttattaacgcgtttattcaaacatgcactgactctttcttttggaat |
329 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36281781 |
ttttaacaaaaactacattttaaaacttcaaaaatcacggtgttgccgtaattttattaacgcgtttattcaaacatgcactgactctttcttttggaat |
36281682 |
T |
|
| Q |
330 |
attcatatgcttcattttcggccatttttgtagccctttttattgattt |
378 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36281681 |
at--gaatgcttcattttcggccatttttgtagccctttttattgattt |
36281635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 42; Significance: 0.000000000000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 65 - 138
Target Start/End: Original strand, 2797347 - 2797420
Alignment:
| Q |
65 |
tttggtggggttttgaggatgtgggaaggtgaactttttgattgctttgatcatcgtcgcattgctctagaatc |
138 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| || ||||||| || || |||||||| |||||||| ||||| |
|
|
| T |
2797347 |
tttggtggtgttttgaggatgtgggaaggtgaagttcttgattgtttcgagcatcgtcgaattgctcttgaatc |
2797420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 94 times since January 2019
Visitors: 6125