View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0876_low_20 (Length: 293)
Name: NF0876_low_20
Description: NF0876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0876_low_20 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 55 - 293
Target Start/End: Complemental strand, 43411386 - 43411148
Alignment:
| Q |
55 |
agacgtggatgacgactaccaatctgatttccgatgtcctttttgtgattttgaaattcaagttcctctctgcagtgattttgaagaggagtattgctct |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43411386 |
agacgtggatgacgactaccaatctgatttccgatgtcctttttgtgattttgaaattcaagttcctctctgcagtgattttgaagaggagtattgctct |
43411287 |
T |
 |
| Q |
155 |
tccccaaaaaatgtggtataaccnnnnnnnctgtttccataaattttggtccggcagtaatttttgttgtaatctgttttccatacattttatgcaagca |
254 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
43411286 |
tccccaaaaaatgtggtataacctttttttctgtttccataaattttggtccggcagtaatttttgttgtaatctgttttccatacattttatgcaagta |
43411187 |
T |
 |
| Q |
255 |
agcaatgtttaatatatctgatcctattttttgtacgtc |
293 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
43411186 |
agcaatgtttaatatatctgatcatattttttgtacgtc |
43411148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University