View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0876_low_30 (Length: 226)

Name: NF0876_low_30
Description: NF0876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0876_low_30
NF0876_low_30
[»] chr6 (1 HSPs)
chr6 (1-108)||(34870779-34870886)


Alignment Details
Target: chr6 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 1 - 108
Target Start/End: Original strand, 34870779 - 34870886
Alignment:
1 atttttagattggggttattctcgtgatgattgtctatcaaaacttgtaagatgaatgattttgtttgagtctgagaaatgaagatgtttatgtaattac 100  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
34870779 atttttggattggggttattctcgtgatgattgtctatcaaaacttgtaagatgaatgattttgtttgagtttgagaaatgaagatgtttatgtaattac 34870878  T
101 gagctcaa 108  Q
     |||||||    
34870879 aagctcaa 34870886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3211 times since January 2019
Visitors: 6172