View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0876_low_31 (Length: 217)
Name: NF0876_low_31
Description: NF0876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0876_low_31 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 1 - 147
Target Start/End: Complemental strand, 3238639 - 3238493
Alignment:
Q |
1 |
ttaagaagaaactgtgctatatatgtatacggtaattctcaatcaattacaggttgatcgagctgtgacactcgccatttctcaaaatgaagggttaccg |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3238639 |
ttaagaagaaactgtgctatatatgtatacggtaattctcaatcaattacaggttgatcgagctgtgacactcgccatttctcaaaatgaagggttaccg |
3238540 |
T |
 |
Q |
101 |
tatacatatacagcacagtttcgatcgagctgtgacctatgatactc |
147 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
T |
3238539 |
tatacatatacagcacagtttcgatcgagctgtgacctgtgacactc |
3238493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University