View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0876_low_32 (Length: 210)
Name: NF0876_low_32
Description: NF0876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0876_low_32 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 107; Significance: 8e-54; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 41 - 205
Target Start/End: Original strand, 6092995 - 6093158
Alignment:
Q |
41 |
ggagaggtgagagggttcatatgcaattcgagttggtaggaggaattagaacgtaattttggtgatggatcaaagtcatgcatggttggaatcatcaggc |
140 |
Q |
|
|
||||||||||||||||| | || ||||| |||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6092995 |
ggagaggtgagagggttaacattcaattagagttggtaggaggaattagaatgaaattttggtgatggatcaaagtcatgcatggttggaatcatcaggc |
6093094 |
T |
 |
Q |
141 |
ttcttcatttatcaattgatcatgannnnnnngtgtgggttggactgatatttttggtttaaact |
205 |
Q |
|
|
||||||||||||||||||||||||| |||| ||||||||||||||||||||| |||||| |
|
|
T |
6093095 |
ttcttcatttatcaattgatcatga-ttttttgtgtaggttggactgatatttttggtgtaaact |
6093158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University