View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0876_low_35 (Length: 205)

Name: NF0876_low_35
Description: NF0876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0876_low_35
NF0876_low_35
[»] chr3 (1 HSPs)
chr3 (1-125)||(6092997-6093121)
[»] chr6 (1 HSPs)
chr6 (58-125)||(15391904-15391971)


Alignment Details
Target: chr3 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 1 - 125
Target Start/End: Complemental strand, 6093121 - 6092997
Alignment:
1 aatcatgatcaattgataaatgaagaagcctgatgattccaaccatgcatgactttgatccatcaccaaaatttcattctaattcctcctaccaactcta 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6093121 aatcatgatcaattgataaatgaagaagcctgatgattccaaccatgcatgactttgatccatcaccaaaatttcattctaattcctcctaccaactcta 6093022  T
101 attgaatgttaaccctctcacctct 125  Q
    |||||||||||||||||||||||||    
6093021 attgaatgttaaccctctcacctct 6092997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 58 - 125
Target Start/End: Complemental strand, 15391971 - 15391904
Alignment:
58 atccatcaccaaaatttcattctaattcctcctaccaactctaattgaatgttaaccctctcacctct 125  Q
    ||||||||||||||| ||||||||||| | ||||||| |||||||||| |||| |  |||||||||||    
15391971 atccatcaccaaaatctcattctaattgcccctaccacctctaattgagtgttgaatctctcacctct 15391904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3086 times since January 2019
Visitors: 6169