View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0876_low_35 (Length: 205)
Name: NF0876_low_35
Description: NF0876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0876_low_35 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 1 - 125
Target Start/End: Complemental strand, 6093121 - 6092997
Alignment:
| Q |
1 |
aatcatgatcaattgataaatgaagaagcctgatgattccaaccatgcatgactttgatccatcaccaaaatttcattctaattcctcctaccaactcta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6093121 |
aatcatgatcaattgataaatgaagaagcctgatgattccaaccatgcatgactttgatccatcaccaaaatttcattctaattcctcctaccaactcta |
6093022 |
T |
|
| Q |
101 |
attgaatgttaaccctctcacctct |
125 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
6093021 |
attgaatgttaaccctctcacctct |
6092997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 58 - 125
Target Start/End: Complemental strand, 15391971 - 15391904
Alignment:
| Q |
58 |
atccatcaccaaaatttcattctaattcctcctaccaactctaattgaatgttaaccctctcacctct |
125 |
Q |
| |
|
||||||||||||||| ||||||||||| | ||||||| |||||||||| |||| | ||||||||||| |
|
|
| T |
15391971 |
atccatcaccaaaatctcattctaattgcccctaccacctctaattgagtgttgaatctctcacctct |
15391904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3086 times since January 2019
Visitors: 6169