View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0876_low_8 (Length: 396)
Name: NF0876_low_8
Description: NF0876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0876_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 91; Significance: 5e-44; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 23 - 145
Target Start/End: Complemental strand, 53834470 - 53834348
Alignment:
Q |
23 |
aatatccacacagaaaatatattgnnnnnnnnggaagaaatatatacgaaaatatacctcttagtataagataattttgttcaacatcaacatgtcaata |
122 |
Q |
|
|
|||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
53834470 |
aatatccacacagaaaatgtattgttttttttggaagaaatatatacgaaaatatacctcttagtataagataattttgttcaacaccaacatgtcaata |
53834371 |
T |
 |
Q |
123 |
attgtagaacctttctcttaaag |
145 |
Q |
|
|
||||||||||||||||||||||| |
|
|
T |
53834370 |
attgtagaacctttctcttaaag |
53834348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 167 - 252
Target Start/End: Complemental strand, 53834323 - 53834238
Alignment:
Q |
167 |
acaagatatcaatccagaaacctctcactctaactaagcttattattatttttaactaagatctcactaagaaatgtttttgcata |
252 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
T |
53834323 |
acaagatatcaatccagaaacctctcactctaactaagcttattattatgtttaattaagatctcactaagaaatgtttttgcata |
53834238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 149 times since January 2019
Visitors: 6125