View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0877_high_1 (Length: 632)
Name: NF0877_high_1
Description: NF0877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0877_high_1 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 541; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 541; E-Value: 0
Query Start/End: Original strand, 1 - 625
Target Start/End: Complemental strand, 42366154 - 42365539
Alignment:
Q |
1 |
ttcagcgaaagctgagaaggcttaaggacaaagaaattgatcatggtcgccacatgaagggatccaataggttgaaatttagagaggcagtattgccatt |
100 |
Q |
|
|
||||| |||||||||||| | ||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42366154 |
ttcagagaaagctgagaaagattaaggaaaaagaaactgatcatggtcgccacatgaagggatccaataggttgaaatttagagaggcagtattgccatt |
42366055 |
T |
 |
Q |
101 |
acccactgaggatgaggaggatgaaactgaaatctcccctcagaaggaggaagaagaagaacttattgaagaggttggtaccttaattgttgatattaat |
200 |
Q |
|
|
|||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42366054 |
acccac---------ggaggatgaaactgaaatctccccacagaaggaggaagaagaagaacttattgaagaggttggtaccttaattgttgatattaat |
42365964 |
T |
 |
Q |
201 |
cattatgtagctagaagtatcatattaggctgtgtcattctagaaatataactgaaaattatcctgcaaactgattagaaaaacttcaatttcacgtttg |
300 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
42365963 |
cattatgtagctagaagtatcatattaggctgtgtcattctagaaatataattgaaaattatcctccaaactgattagaaaaacttcaatttcacgtttg |
42365864 |
T |
 |
Q |
301 |
gaagtagatttgcagtttgctcttacactatttatgttgattgatgatatatcattacttatcaatagattctgctgttgttttgttatttattgtttat |
400 |
Q |
|
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||| |||||| |||||||||||||||||||||| |
|
|
T |
42365863 |
gaagtagatttgcagtttgctcttacactgtttatgttgattgatgatatatcattacttatcaagagatgctgctgctgttttgttatttattgtttat |
42365764 |
T |
 |
Q |
401 |
tttccttacattgcacttactctagttgtgaggctgttttacaggttgttcggacaaaatacttcgacatgcctcctttaactgtgtttgaagcaattga |
500 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42365763 |
tttccttacattgcacttactctagttgtgaggctgttttacaggttgttcggacaaaatacttcgacatgcctcctttaactgtgtttgaagcaattga |
42365664 |
T |
 |
Q |
501 |
ccagttggaaatggttgctcatgacttctatgcttttcgaaatgaagaatctggtcagtaaatactactgttttagctatctttggtttgaccatgtttc |
600 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42365663 |
ccagttggaaatggttgctcatgacttctatgcttttcgaaatgaagaatctggtcagtaaatactactgttttagctatctttggtttgaccatgtttc |
42365564 |
T |
 |
Q |
601 |
tcactacattttattgtctctgctc |
625 |
Q |
|
|
|||||||||||||||||||| |||| |
|
|
T |
42365563 |
tcactacattttattgtctcggctc |
42365539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 861 times since January 2019
Visitors: 6134