View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0877_high_10 (Length: 273)
Name: NF0877_high_10
Description: NF0877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0877_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 28505441 - 28505197
Alignment:
Q |
1 |
cacgaccaacaattggagctaatataaatttaggatctttttaccttgttggtatgccagttgcaatctttttaggatttgtggctaaattggggtttcc |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| |
|
|
T |
28505441 |
cacgaccaacaattggagctaatataaatttaggatctttttaccttgttggtatgccagttgcaatctttctaggatttgtggctaaattgggatttcc |
28505342 |
T |
 |
Q |
101 |
agggttgtggattgggttacttgcagctcaaggctcatgtgctatgcttatgttggttgttctttgtagaactgattggaatttgcaagttcaaagagct |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28505341 |
agggttgtggattgggttacttgcagctcaaggctcatgtgctatgcttatgttggttgttctttgtagaactgattggaatttgcaagttcaaagagct |
28505242 |
T |
 |
Q |
201 |
aaagaactcacaaaaagttcaactacaagtgatgatgttgatgct |
245 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28505241 |
aaagaactcacaaaaagttcaactacaagtgatgatgttgatgct |
28505197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 112 - 182
Target Start/End: Original strand, 51875502 - 51875572
Alignment:
Q |
112 |
ttgggttacttgcagctcaaggctcatgtgctatgcttatgttggttgttctttgtagaactgattggaat |
182 |
Q |
|
|
|||||||||||||||| |||||||| |||||||| || |||||| ||| ||||||| ||| ||||||||| |
|
|
T |
51875502 |
ttgggttacttgcagcccaaggctcttgtgctattctcatgttgtatgtgctttgtacaacggattggaat |
51875572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University