View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0877_high_6 (Length: 303)
Name: NF0877_high_6
Description: NF0877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0877_high_6 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 83 - 303
Target Start/End: Complemental strand, 42366569 - 42366349
Alignment:
| Q |
83 |
taattaaggttatgatagcaacggttagtgtaattgtataactgatttactaactttggttgagttcagctgaatgatgcggtgaaacagcacgtagagg |
182 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42366569 |
taattaaggttatgaaagcaacggttagtgtgattgtataactcatttactaactgtggttgagttcagctgaatgatgcggtgaaacagcacgtagagg |
42366470 |
T |
|
| Q |
183 |
agaaagtgggaagagcagttcagaagcacagctatttagtcagggaagttgatgtcaggctatctacccgcggtggaggagaatttggtcgaggacctag |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
42366469 |
agaaagtgggaagagcagttcagaagcacagctatttagtcagggaagttgatgtcaggctatctactcgcggtggaggagaatttggtcgaggacctag |
42366370 |
T |
|
| Q |
283 |
aacacgtagatgtgaggtagt |
303 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
42366369 |
aacacgtagatgtgaggtagt |
42366349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2480 times since January 2019
Visitors: 6164