View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0877_low_10 (Length: 301)
Name: NF0877_low_10
Description: NF0877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0877_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 16 - 264
Target Start/End: Original strand, 36806941 - 36807195
Alignment:
Q |
16 |
attacaattaactaaggtgtttaaaagtcgtatacaagtaactaaggtgtttaaaagtcgtggagaatttaagcctcttagtttgatctttttggatcat |
115 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36806941 |
attacaattaactaaggtgtttaaaagtcgtatacaagtaactaaggtgtttaaaagtcgtggagaatttaagcctcttagtttgatctttttggatcac |
36807040 |
T |
 |
Q |
116 |
gagccttctcacgcac----nnnnnnnnnnnncacaaactag--tatgtttctacactccaattgagccaagatattggatttggggaaatcaattcgct |
209 |
Q |
|
|
|||||||||||||||| ||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36807041 |
gagccttctcacgcacaaaaaaaaaaaaaaaatacaaactagtatatgtttctacacttcaattgagccaagatattggatttggggaaatcaattcgct |
36807140 |
T |
 |
Q |
210 |
cttaaatcaacaaaagaggtcatttaactataagaagttgattgtgtaatctgga |
264 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36807141 |
tttaaatcaacaaaagaggtcatttaactataagaagttgattgtgtaatctgga |
36807195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1586 times since January 2019
Visitors: 6145