View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0877_low_4 (Length: 453)
Name: NF0877_low_4
Description: NF0877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0877_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 97 - 417
Target Start/End: Complemental strand, 2628202 - 2627879
Alignment:
Q |
97 |
gtcgggtgctgattggtggctgtgttttggtctttgccttgattgtctgtctgctgttatgcctttgcaattgagtccctcaggatgccaggtctgtagt |
196 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2628202 |
gtcgggtgctgattggtggctgtgttttggtctttgccttgattgtctgtctgttgttacgcctttgcaattgagtccctcaggatgccaggtctgtagt |
2628103 |
T |
 |
Q |
197 |
ggtttgtgtttaggtgatttgcgttttcttttttctaagagccagctgttaattctgtgaccctctaa---ggtgttttggggttgctgtatcagcagtt |
293 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
2628102 |
ggtttgtgtttaggtgatttgcgttttcttttttctaagagccagctgttaattctgtgaccctctaaggtggtgttttggggttgctgtatcagcagtt |
2628003 |
T |
 |
Q |
294 |
ttagctacaggggcagttgtttttggtagttcttagttgtttttctgctattcagaattttatttgtatcttcaatctcaagcgcagtttgtgctcaagt |
393 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2628002 |
ttagctacaggggcagttgtttttggtagttcttagttgtttttctgctattcagaattttatttgtatcttcaatctcaagcgcagtttgtgctcaagt |
2627903 |
T |
 |
Q |
394 |
gttttcaataaaagtttagctatt |
417 |
Q |
|
|
|||||||||||||||||||||||| |
|
|
T |
2627902 |
gttttcaataaaagtttagctatt |
2627879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University