View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0877_low_7 (Length: 347)
Name: NF0877_low_7
Description: NF0877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0877_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 26 - 339
Target Start/End: Complemental strand, 2083535 - 2083221
Alignment:
| Q |
26 |
tggttttaggcatgcaatactgtgtacatatgctgtagtggattagtctctcaagtttcagtttcagctagactagtgtaaagttgattttcgaataatt |
125 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2083535 |
tggttttaggcatgcaatactgtgtgcatgtgctgtagtggattagtctctcaagtttcagtttcagctagactagtgtaaagttgatttttgaataatt |
2083436 |
T |
|
| Q |
126 |
gcatttgga-cacaacattgcaaagatgggggtgtgtgtaaactggtaacaatgtgccctttttcatattgttgtttttgataactttattgtaaatttg |
224 |
Q |
| |
|
||||||||| || |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2083435 |
gcatttggaacaaaacattgcaaagatgggg-tgtgtgtaaactggtaacaatgtgccctttttcatattgttgtttttgataactttattgtaaatttg |
2083337 |
T |
|
| Q |
225 |
cctcaattttatggtttactgatctgttatgta-tgtttggaggaatttcatcgtgcttttgattaatgggannnnnnnnngtcctccaaatcaagcttt |
323 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2083336 |
cctcaattttatggcttactgatctgttatgtattgtttggaggaatttcattgtgcttttgattaatgggatttttttttgtcctccaaatcaagcttt |
2083237 |
T |
|
| Q |
324 |
cgactcaacctatgat |
339 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
2083236 |
cgactcaacctgtgat |
2083221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1108 times since January 2019
Visitors: 6137