View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0878_high_10 (Length: 372)
Name: NF0878_high_10
Description: NF0878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0878_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 29 - 363
Target Start/End: Original strand, 48153422 - 48153765
Alignment:
Q |
29 |
agtttctaccttgttgtcaaccatagtctcaagaaaggctacttgagtcctaataaaatcaaagacgggttcaattggtggtagaggtgtatcatagcgc |
128 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48153422 |
agtttctaccttgttgtcaaccatagtctcaagagaggctacttgagtcctaataaaatcaaagacgggttcaattggtggtagaggtgtatcatagcgc |
48153521 |
T |
 |
Q |
129 |
ctacgaacacgaccacgcccaccacggccccttccaccagcaaggtgagcttgatcggcttctggatgttgcggatatggtccctcaaccacaggcataa |
228 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48153522 |
ctacgaacacgaccacgcccaccacggccccttccaccagcaaggtgagcttgatcggcttctggatgttgcggatatggtccctcaaccacaggcataa |
48153621 |
T |
 |
Q |
229 |
gaacatgaccacgcccatgc---------ccacggccccttcggccagcaaggtgagcttgatcagcttctgccacatgcattggagcagttcgatatcc |
319 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48153622 |
gaacatgaccacgcccatgcccacggccaccacggccccttcggccagcaaggtgagcttgatcagcttctgccacatgcattggagcagttcgatatcc |
48153721 |
T |
 |
Q |
320 |
acttcataataaagagaaacttcagacataatgtacagaataat |
363 |
Q |
|
|
||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
48153722 |
acttcataacaaagagaaacttcagacataatgtacagaataat |
48153765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2914 times since January 2019
Visitors: 6167