View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0878_high_17 (Length: 284)
Name: NF0878_high_17
Description: NF0878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0878_high_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 2588733 - 2588499
Alignment:
Q |
1 |
atggtcttggtaatgtggatcaatgcatatcgaagtctcgtgatgagaagaattagtttcttcaagttgatgaaccatgttggtatcagaaccctcacat |
100 |
Q |
|
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2588733 |
atggtcttggtaatgtggatcaatgcatattgaagtctcgtgatgagaagaattagtttcttcaagttgatgaaccatgttggtatcagaaccctcacat |
2588634 |
T |
 |
Q |
101 |
gatgataaaggttttcctagattgtgctcatcacattccacatcataatcatctgtttccacagacgcataactgctttcaccaacacaagaagaattta |
200 |
Q |
|
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
2588633 |
gatgataaaggtttttctagattgtgctcatcacattccacatcataatcatctgtttccacagacgcataactgctttcaccaacacaagaagatttta |
2588534 |
T |
 |
Q |
201 |
agaatgattcaggatacatttctcttgccaatctt |
235 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |
|
|
T |
2588533 |
agaatgattcaggatacatttctcttgccaatctt |
2588499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2806 times since January 2019
Visitors: 6167