View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0878_high_23 (Length: 264)
Name: NF0878_high_23
Description: NF0878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0878_high_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 8 - 253
Target Start/End: Complemental strand, 35817276 - 35817031
Alignment:
Q |
8 |
ttgattttactcattttagtggtgcttttaccaaatatttcttattaatttgtttaagatatgacacatggaaaccaaatactaaataaacataaactga |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35817276 |
ttgattttactcattttagtggtgcttttaccaaatatttcttattaatttgtttaagatatgacacatggaaaccaaatactaaataaacataaactga |
35817177 |
T |
 |
Q |
108 |
gataagcttgtgtcagccccgtgatttggggctgttctaaatgcaatgatccctgacttcaattcttctcaaatctcaactacttggcattggttcacat |
207 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35817176 |
gataagcttgtgtcagccccgtgatttggggctgttctaaatgcaatgatccctgacttcaattcttctcaaatctcaactacttggcattggttcacat |
35817077 |
T |
 |
Q |
208 |
tatatttaatgaatttgaccttgtgcatgttggcgttgcaacagct |
253 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35817076 |
tatatttaatgaatttgaccttgtgcatgttggcgttgcaacagct |
35817031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University