View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0878_high_8 (Length: 398)
Name: NF0878_high_8
Description: NF0878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0878_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 29 - 386
Target Start/End: Original strand, 46916981 - 46917333
Alignment:
Q |
29 |
ggaagttttggttgtactgaagcacatgcacatggagtgatctgtgcaagg-ttggttcttctctgctctagacgacnnnnnnnnnnnnnnnnnnnnnca |
127 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| | ||| || |
|
|
T |
46916981 |
ggaagttttggttgtactgaagcacatgcacatggagtgatctgtgcaagggttggttcttctctgctct--aagactagtagagtagtagtagtagtca |
46917078 |
T |
 |
Q |
128 |
ctcattcattcatgtcatgtcatcaacctttacaagaatctctgactatgtcgtcgtcagcctcttcttcatcttcattttc-tatcatcttctttgtac |
226 |
Q |
|
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||| | | |||||||||||||||||||| ||||||||||||||||| |
|
|
T |
46917079 |
ctcattcattcat-tcatgtcatcaacctttacaagaatctctgactatgtcgtcagcctcttcttcttcatcttcattttcctatcatcttctttgtac |
46917177 |
T |
 |
Q |
227 |
ttccgaccgtgttattaccaaatgacgaatccctttctctttttgtttttccacatattccttccatcaccttcttctaatagagattgtgttcacgctc |
326 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
T |
46917178 |
ttccgaccgtgttattaccaaatgacgaatccctttctctttttgtttttccacatattcc----atcaccttcttctaatagagattgttttcacgctc |
46917273 |
T |
 |
Q |
327 |
ttttaaatacattcaacactgcccttttttgagacacacgcgcgccatttctatcttctc |
386 |
Q |
|
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46917274 |
ttttaaatacattcaacagtgcccttttttgagacacacgcgcgccatttctatcttctc |
46917333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University