View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0878_low_23 (Length: 308)
Name: NF0878_low_23
Description: NF0878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0878_low_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 2e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 79 - 242
Target Start/End: Complemental strand, 863745 - 863582
Alignment:
| Q |
79 |
acatcatcatatactaatatgcaaactaaaaaagcgtctatatatgtaaacagcaaagacacaacatgttaatccactattgaggattttattttaaata |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
863745 |
acatcatcatatactaatatgcaaactaaaaaagcgtctatatatgtaaacagcaaagacacaacatgttaatccactattgaggattttattttaaata |
863646 |
T |
|
| Q |
179 |
atagtgatcagtttcatttctaaaatattgctgatatatcatccgctaaaaacatgtcctttgc |
242 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
863645 |
atagtgatcagttgcatttctgaaatattgctgatatatcatctgctaaaaacatgtcctttgc |
863582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1099 times since January 2019
Visitors: 6137