View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0878_low_24 (Length: 302)
Name: NF0878_low_24
Description: NF0878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0878_low_24 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 36; Significance: 0.00000000003; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 83 - 134
Target Start/End: Complemental strand, 35472439 - 35472388
Alignment:
| Q |
83 |
ttgaaatttaaatgtgagtgtttagttttacattgacgattatgaaaagatg |
134 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||| |||||||||||| |
|
|
| T |
35472439 |
ttgaaatttaaatgtgagtgtttaatgatacattgacgactatgaaaagatg |
35472388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 196 - 238
Target Start/End: Complemental strand, 35472327 - 35472285
Alignment:
| Q |
196 |
gatttgatgtcagtatctattaggagtcatggcgtttaattct |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
35472327 |
gatttgatgtcagtatctattaggagtcatgacgtttagttct |
35472285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1004 times since January 2019
Visitors: 6135