View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0878_low_24 (Length: 302)

Name: NF0878_low_24
Description: NF0878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0878_low_24
NF0878_low_24
[»] chr7 (2 HSPs)
chr7 (83-134)||(35472388-35472439)
chr7 (196-238)||(35472285-35472327)


Alignment Details
Target: chr7 (Bit Score: 36; Significance: 0.00000000003; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 83 - 134
Target Start/End: Complemental strand, 35472439 - 35472388
Alignment:
83 ttgaaatttaaatgtgagtgtttagttttacattgacgattatgaaaagatg 134  Q
    |||||||||||||||||||||||| |  ||||||||||| ||||||||||||    
35472439 ttgaaatttaaatgtgagtgtttaatgatacattgacgactatgaaaagatg 35472388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 196 - 238
Target Start/End: Complemental strand, 35472327 - 35472285
Alignment:
196 gatttgatgtcagtatctattaggagtcatggcgtttaattct 238  Q
    ||||||||||||||||||||||||||||||| |||||| ||||    
35472327 gatttgatgtcagtatctattaggagtcatgacgtttagttct 35472285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University