View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0878_low_33 (Length: 264)
Name: NF0878_low_33
Description: NF0878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0878_low_33 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 8 - 253
Target Start/End: Complemental strand, 35817276 - 35817031
Alignment:
| Q |
8 |
ttgattttactcattttagtggtgcttttaccaaatatttcttattaatttgtttaagatatgacacatggaaaccaaatactaaataaacataaactga |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35817276 |
ttgattttactcattttagtggtgcttttaccaaatatttcttattaatttgtttaagatatgacacatggaaaccaaatactaaataaacataaactga |
35817177 |
T |
|
| Q |
108 |
gataagcttgtgtcagccccgtgatttggggctgttctaaatgcaatgatccctgacttcaattcttctcaaatctcaactacttggcattggttcacat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35817176 |
gataagcttgtgtcagccccgtgatttggggctgttctaaatgcaatgatccctgacttcaattcttctcaaatctcaactacttggcattggttcacat |
35817077 |
T |
|
| Q |
208 |
tatatttaatgaatttgaccttgtgcatgttggcgttgcaacagct |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35817076 |
tatatttaatgaatttgaccttgtgcatgttggcgttgcaacagct |
35817031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 731 times since January 2019
Visitors: 6131