View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0878_low_36 (Length: 252)
Name: NF0878_low_36
Description: NF0878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0878_low_36 |
 |  |
|
[»] scaffold0027 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0027 (Bit Score: 77; Significance: 8e-36; HSPs: 2)
Name: scaffold0027
Description:
Target: scaffold0027; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 124 - 231
Target Start/End: Complemental strand, 17141 - 17036
Alignment:
Q |
124 |
agaaaaggcccacaaaaatatgggagatcttacttccatactcgaaaaattattgtttcttattcttttcctacatacccatgaaaaaatattttgagtt |
223 |
Q |
|
|
||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||| ||| | |||||||||||||||||| |||| |
|
|
T |
17141 |
agaaaaggcccacaaaaatatggaagatcttatttccatactcgaaaaattattgtttcttattctttttctatacacccatgaaaaaatattt--agtt |
17044 |
T |
 |
Q |
224 |
tgcatcat |
231 |
Q |
|
|
|||||||| |
|
|
T |
17043 |
tgcatcat |
17036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0027; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 30 - 85
Target Start/End: Complemental strand, 17370 - 17316
Alignment:
Q |
30 |
gtgaatccatgtgtaaacctgatcatttgactcctcaacttataaacaactttctt |
85 |
Q |
|
|
|||||||||||||||| |||||||| |||||| |||||||||||| |||||||||| |
|
|
T |
17370 |
gtgaatccatgtgtaa-cctgatcacttgactactcaacttataatcaactttctt |
17316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University