View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0878_low_43 (Length: 228)
Name: NF0878_low_43
Description: NF0878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0878_low_43 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 23 - 192
Target Start/End: Complemental strand, 19315181 - 19315010
Alignment:
| Q |
23 |
tgaagaaatcacaaagagagaga--ttatatagaaatgcaacctgcagaccatgtggtcgcagcccatagatctagcaacataaattctgcatttgggac |
120 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19315181 |
tgaagaaatcacaaagagagagagattatatagaaatgcaacctgcagaccatgtggtcgcagcccatagatctagcaacataaattctgcatttgggac |
19315082 |
T |
|
| Q |
121 |
atctcatccatttcttctttttagctaggcgcatcaacatgacaacctctttcttcgtctcatcggcattca |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
19315081 |
atctcatccatttcttctttttagctaggcgcatcaacatgacatcctctttcttcgtctcatcggcattca |
19315010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 96 - 181
Target Start/End: Complemental strand, 19270818 - 19270733
Alignment:
| Q |
96 |
gcaacataaattctgcatttgggacatctcatccatttcttctttttagctaggcgcatcaacatgacaacctctttcttcgtctc |
181 |
Q |
| |
|
|||||||||||||||||||| ||||||| | |||| ||||| | ||||| |||||||||||||| ||| | ||||||||| |||| |
|
|
| T |
19270818 |
gcaacataaattctgcatttaggacatcgcctccacttcttatccttagcaaggcgcatcaacataacatcttctttcttcctctc |
19270733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3085 times since January 2019
Visitors: 6169