View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0878_low_45 (Length: 225)
Name: NF0878_low_45
Description: NF0878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0878_low_45 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 3 - 128
Target Start/End: Original strand, 44188451 - 44188576
Alignment:
| Q |
3 |
tacaaaatgctgggacactaaggcaagtttgttggctgctaaacaagaccaatatcagtggtccgtttgagatatcaaagaattcttttgacaacattct |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44188451 |
tacaaaatgctgggacactaaggcaagtttgttggctgctaaacaagaccaatatcagtggtccgtttgagatatcaaagaattcttttgacaacattct |
44188550 |
T |
 |
| Q |
103 |
aatgagattgcaaatgcagtagttgg |
128 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
44188551 |
aatgagattgcaaatgcagtagttgg |
44188576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 3 - 80
Target Start/End: Original strand, 1329684 - 1329761
Alignment:
| Q |
3 |
tacaaaatgctgggacactaaggcaagtttgttggctgctaaacaagaccaatatcagtggtccgtttgagatatcaa |
80 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||||| ||||||| || |||||||| |||||||||||| |
|
|
| T |
1329684 |
tacaaaatgctggcagactaaggcaagtttgttggctgctaaacgagaccaaaattagtggtcccattgagatatcaa |
1329761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University