View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0878_low_46 (Length: 219)

Name: NF0878_low_46
Description: NF0878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0878_low_46
NF0878_low_46
[»] chr3 (1 HSPs)
chr3 (20-170)||(50307898-50308048)


Alignment Details
Target: chr3 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 20 - 170
Target Start/End: Complemental strand, 50308048 - 50307898
Alignment:
20 cttttgatcttctactttttctttcgcctcgataacttctccttcatttgttgaatcattcatttcttttttatcactctcattaatgttgccttcttct 119  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
50308048 cttttgatcttctactttttctttcgcctcgataacttctccttcatttgttgaatcattcatttcttttttatcactctcattaatgttcccttcttct 50307949  T
120 tggtttgtatccgtattttcattttggtcttgattatcttcatgttcatct 170  Q
    ||||||||||||||||| |||||||| ||||||||||||||||||||||||    
50307948 tggtttgtatccgtattctcattttgatcttgattatcttcatgttcatct 50307898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3323 times since January 2019
Visitors: 6172