View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0878_low_46 (Length: 219)
Name: NF0878_low_46
Description: NF0878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0878_low_46 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 20 - 170
Target Start/End: Complemental strand, 50308048 - 50307898
Alignment:
Q |
20 |
cttttgatcttctactttttctttcgcctcgataacttctccttcatttgttgaatcattcatttcttttttatcactctcattaatgttgccttcttct |
119 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
50308048 |
cttttgatcttctactttttctttcgcctcgataacttctccttcatttgttgaatcattcatttcttttttatcactctcattaatgttcccttcttct |
50307949 |
T |
 |
Q |
120 |
tggtttgtatccgtattttcattttggtcttgattatcttcatgttcatct |
170 |
Q |
|
|
||||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
T |
50307948 |
tggtttgtatccgtattctcattttgatcttgattatcttcatgttcatct |
50307898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University