View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0878_low_47 (Length: 219)

Name: NF0878_low_47
Description: NF0878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0878_low_47
NF0878_low_47
[»] chr7 (1 HSPs)
chr7 (1-41)||(46916981-46917021)


Alignment Details
Target: chr7 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 46917021 - 46916981
Alignment:
1 atcactccatgtgcatgtgcttcagtacaaccaaaacttcc 41  Q
    |||||||||||||||||||||||||||||||||||||||||    
46917021 atcactccatgtgcatgtgcttcagtacaaccaaaacttcc 46916981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University