View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0878_low_50 (Length: 205)
Name: NF0878_low_50
Description: NF0878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0878_low_50 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 18 - 191
Target Start/End: Original strand, 35034569 - 35034745
Alignment:
Q |
18 |
gaaagggatgctaaagatccaaaatatgtacttgttacatatgatggaaaacatacacatggacctgtcgttgataagaaaag---accaacatactcga |
114 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||| |||||||||||||| |
|
|
T |
35034569 |
gaaagggatgctaaagatccaaaatatgtacttgttacatatgatggaaaacatacccatggacctgtcattgataagaaaagtcgaccaacatactcga |
35034668 |
T |
 |
Q |
115 |
gaaatactaatgcagctggagtgcgtagaaatgtcagcatgccgccaccaccatcaccaccatctgcattgcctatg |
191 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35034669 |
gaaatactaatgcagctggagtgcgtagaaatgccagcatgccgccaccaccatcaccaccatctgcattgcctatg |
35034745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University