View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0879_high_1 (Length: 426)
Name: NF0879_high_1
Description: NF0879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0879_high_1 |
 |  |
|
| [»] scaffold0057 (4 HSPs) |
 |  |  |
|
| [»] scaffold0049 (1 HSPs) |
 |  |  |
|
| [»] scaffold0311 (1 HSPs) |
 |  |  |
|
| [»] scaffold0168 (1 HSPs) |
 |  |  |
|
| [»] scaffold0258 (1 HSPs) |
 |  |  |
|
| [»] scaffold1176 (1 HSPs) |
 |  |  |
|
| [»] scaffold0187 (2 HSPs) |
 |  |  |
|
| [»] scaffold0015 (1 HSPs) |
 |  |  |
|
| [»] scaffold0223 (1 HSPs) |
 |  |  |
|
| [»] scaffold0254 (1 HSPs) |
 |  |  |
|
| [»] scaffold0180 (1 HSPs) |
 |  |  |
|
| [»] scaffold0018 (1 HSPs) |
 |  |  |
|
| [»] scaffold0005 (1 HSPs) |
 |  |  |
|
| [»] scaffold0167 (1 HSPs) |
 |  |  |
|
| [»] scaffold0036 (1 HSPs) |
 |  |  |
|
| [»] scaffold0954 (1 HSPs) |
 |  |  |
|
| [»] scaffold0028 (1 HSPs) |
 |  |  |
|
| [»] scaffold0116 (1 HSPs) |
 |  |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |  |
|
| [»] scaffold0194 (2 HSPs) |
 |  |  |
|
| [»] scaffold0031 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 264; Significance: 1e-147; HSPs: 82)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 62 - 365
Target Start/End: Original strand, 42805494 - 42805797
Alignment:
| Q |
62 |
gtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaataca |
161 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
42805494 |
gtaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgtgtacaataca |
42805593 |
T |
 |
| Q |
162 |
ccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttttagtgaaaattataaaaataatatttctaac |
261 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42805594 |
ccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccctttttagtgaaaattataaaaataatatttctaag |
42805693 |
T |
 |
| Q |
262 |
tgaagttcaaaataagtaactcaagaccagttttttacatgtaactcttgcatatcctaagcactccataccttgaaccgcacactgtttcaaatgtctc |
361 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42805694 |
tgaagttcaaaataagtaactcaagaccagttttttacatgtaactcttgcatatcctaagcactccataccttgaaccgcacactgtttcaaatgtctt |
42805793 |
T |
 |
| Q |
362 |
tgct |
365 |
Q |
| |
|
|||| |
|
|
| T |
42805794 |
tgct |
42805797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 126; E-Value: 8e-65
Query Start/End: Original strand, 64 - 229
Target Start/End: Original strand, 47716431 - 47716596
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
|||||| |||||||||| ||||| ||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
47716431 |
aactggaaaagttgttgccatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacacc |
47716530 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
47716531 |
aataatggtgggaccccttcccggaccccgcatatgcgggagctttggtgcaccgggttgcccttt |
47716596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 64 - 230
Target Start/End: Complemental strand, 21172170 - 21172008
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||| ||||||| |||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
21172170 |
aactggtaaagttgttgtcatgtaactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacacc |
21172073 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
|| |||||||||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
21172072 |
aa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
21172008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 64 - 200
Target Start/End: Original strand, 46354166 - 46354302
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
46354166 |
aactggtaaagttgttgtcatgtgattggaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaaggctgcgtacaatacacc |
46354265 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgc |
200 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |
|
|
| T |
46354266 |
aataatggtgggaccccttcccggaccccgcatatgc |
46354302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 106; E-Value: 7e-53
Query Start/End: Original strand, 64 - 232
Target Start/End: Original strand, 42798641 - 42798807
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| ||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
42798641 |
aactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcttggaaacagtctcttgtgtaaaaaacaaggtaaggctgcgtacaatacacc |
42798740 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttta |
232 |
Q |
| |
|
| ||||||||||||| ||||| ||||| ||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
42798741 |
a--aatggtgggaccctttcccggaccctgcatatgcgggagctatagtgcatcgggttgcccttttta |
42798807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 64 - 231
Target Start/End: Original strand, 43557444 - 43557612
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||| |||||||||| ||||||| ||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
43557444 |
aactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacagcctcttgtgtaaaaaacagagtaaggctgcgtacaatacacc |
43557543 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagc-tttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
||||||||||||||||| |||| ||| | || ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43557544 |
aataatggtgggaccccctcccggactctgcgtatgcgggagcttttagtgcaccgggttgcccttttt |
43557612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 64 - 229
Target Start/End: Complemental strand, 2541183 - 2541019
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaa-ggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacac |
162 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||||||||||||| ||||||| |||||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
2541183 |
aactggtaaagttgttgtcatgtgactggaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtactatacac |
2541084 |
T |
 |
| Q |
163 |
caataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
|| ||||||||||||||||||| | ||| || ||||||||||||||||||||||||||| |||||| |
|
|
| T |
2541083 |
ca--aatggtgggaccccttcccggtccctgcgtatgcgggagctttagtgcaccgggtttcccttt |
2541019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 64 - 228
Target Start/End: Complemental strand, 11617751 - 11617589
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||| ||||||||| ||||||||||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
11617751 |
aactggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaagactgcgtacaatacacc |
11617652 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctt |
228 |
Q |
| |
|
| |||||||||||||||||| ||||| || ||||| ||| ||||||||||||||||||||||| |
|
|
| T |
11617651 |
a--aatggtgggaccccttcctggaccctgcgtatgcaggacctttagtgcaccgggttgccctt |
11617589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 64 - 231
Target Start/End: Original strand, 32758233 - 32758396
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||| ||||||||| ||||||| |||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
32758233 |
aactggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaa--cagggtaaggctgtgtacaatacacc |
32758330 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|| |||||||||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32758331 |
aa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttttt |
32758396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 64 - 229
Target Start/End: Complemental strand, 48735284 - 48735122
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgag-ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacac |
162 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||||| |||||||||||||||||||||| || ||||||||||| |||||||||| |
|
|
| T |
48735284 |
aactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtccttggaaacaacctcttgtgtaaaacac--ggtaaggctgcgtacaatacac |
48735187 |
T |
 |
| Q |
163 |
caataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
||| |||||||||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
48735186 |
caa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
48735122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 64 - 231
Target Start/End: Original strand, 27629606 - 27629771
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||| | || | |||||||||||||||||| ||||||| |||||||||||||||||||||||||| ||| || |||||||| |
|
|
| T |
27629606 |
aactggtaaagttgttgtcatttgaccgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggttgcgtaaaatacacc |
27629705 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
| ||||||||||||||||||| | ||| |||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
27629706 |
a--aatggtgggaccccttcccgggccctgcatatgcggtagcttcagtgcaccgggttgcccttttt |
27629771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 64 - 229
Target Start/End: Complemental strand, 10693234 - 10693073
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
|||| |||||||||||||||||| |||| |||||||||||||||||| ||||||| |||||||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
10693234 |
aactagtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaga--gggtaaggctgcgtacaatacacc |
10693137 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
|| |||||||||||||||||| ||||| ||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
10693136 |
aa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcactgggttgcccttt |
10693073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 74 - 231
Target Start/End: Complemental strand, 42391251 - 42391098
Alignment:
| Q |
74 |
gttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtg |
173 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||| ||||||| | |||||||||||| |||||||||||||| ||||||||||||| |||||| |
|
|
| T |
42391251 |
gttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcttcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtg |
42391156 |
T |
 |
| Q |
174 |
ggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42391155 |
ggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttttt |
42391098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 64 - 231
Target Start/End: Complemental strand, 19427052 - 19426888
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| || | |||||||||||||||||| ||||||| |||||||||||||||| |||||||| |||| ||||||||||| |
|
|
| T |
19427052 |
aactggtaaagttgttgtcatgtgaccgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaatagggtaagactgcgtacaatacacc |
19426953 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
| |||||||||| |||||| | ||||| ||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
19426952 |
a--aatggtggga-cccttctcggaccctgcatatgcgagagcttcagtgcaccgggttgcccttttt |
19426888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 66 - 225
Target Start/End: Complemental strand, 33872070 - 33871914
Alignment:
| Q |
66 |
ctggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaa |
165 |
Q |
| |
|
||||||||||||||||||||| |||| |||||| ||||||||||| ||||||||||||||||||| |||||||| ||||||||| |||||||||||| |
|
|
| T |
33872070 |
ctggtaaagttgttgtcatgtgactgaaaggtcgcgggttcaagtcctggaaacaacctcttgtgta-aaaacaggataaggctgcgtacaatacacca- |
33871973 |
T |
 |
| Q |
166 |
taatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcc |
225 |
Q |
| |
|
||||||||||||||||||||||||| | |||||| ||||||||||||||| ||||||| |
|
|
| T |
33871972 |
-aatggtgggaccccttcccagaccctgtgtatgcgagagctttagtgcaccaggttgcc |
33871914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 93 - 231
Target Start/End: Original strand, 7879639 - 7879775
Alignment:
| Q |
93 |
aaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagacccc |
192 |
Q |
| |
|
|||||||||||||||||| |||||||| ||||||||||||||||| ||||||||||| |||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
7879639 |
aaggtcacgggttcaagtcctggaaacaatctcttgtgtaaaaaacaaggtaaggctgcgtacaatacacca--aatggtgggaccccttcccggaccct |
7879736 |
T |
 |
| Q |
193 |
gcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7879737 |
gcgtatgcgggagcttcagtgcaccgggttgcccttttt |
7879775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 230 - 365
Target Start/End: Original strand, 42763053 - 42763191
Alignment:
| Q |
230 |
ttagtgaaaattataaaaataatatttctaac---tgaagttcaaaataagtaactcaagaccagttttttacatgtaactcttgcatatcctaagcact |
326 |
Q |
| |
|
||||| |||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||| || |||||||||||| ||||| || |
|
|
| T |
42763053 |
ttagtaaaaattataaaattaatatttctaaaaagtgaagttcaaaataagtaactcaagaccagttttttacatctagctcttgcatatcttaagcgct |
42763152 |
T |
 |
| Q |
327 |
ccataccttgaaccgcacactgtttcaaatgtctctgct |
365 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||| |||| |
|
|
| T |
42763153 |
ccataccttgaactgcacacagtttcaaatgtctttgct |
42763191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 68 - 230
Target Start/End: Original strand, 40463853 - 40464012
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
167 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||||||| | |||||| ||||||||| |||||| |||||||||||| || ||||||||| | |
|
|
| T |
40463853 |
ggtaaagttgttgtcatgtgactgtaaggtcacgggttcaagtcatagaaacagtctcttgtgt-aaaaactgggtaaggctgcgtataatacacca--a |
40463949 |
T |
 |
| Q |
168 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
|||||||||||||||| | ||||| || ||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
40463950 |
atggtgggaccccttctcggaccctgcgtatgcgggagcttcagtgcaccgagttgccctttt |
40464012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 79; E-Value: 9e-37
Query Start/End: Original strand, 64 - 229
Target Start/End: Complemental strand, 22699133 - 22698967
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||| | |||||||||| ||||| | |||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
22699133 |
aactggtaaagttgttgtcatgtgactgaaaggttatgggttcaagtcctggaaatagtctcttgtgtaaaaaacagggtaagactgcgtacaatacacc |
22699034 |
T |
 |
| Q |
164 |
aataatggtgggaccc-cttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
|| ||||||||||||| ||||| ||||| | |||||||||||| |||||||||||||| |||||| |
|
|
| T |
22699033 |
aaaaatggtgggacccttttcccggaccctgtgtatgcgggagctatagtgcaccgggttacccttt |
22698967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 64 - 227
Target Start/End: Complemental strand, 35334977 - 35334818
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |||||||| ||||||| ||| ||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
35334977 |
aactggtaaagttgttgtcatgtgactggaaggtcacgagttcaagtcctggaaacagtctc--gtgtaaaaaacagggtaagactgtgtacaatacacc |
35334880 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccct |
227 |
Q |
| |
|
| |||||||||||||||||| ||||| || ||||| ||||||||||||||||||||| |||| |
|
|
| T |
35334879 |
ga--atggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcaccgggtttccct |
35334818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 68 - 228
Target Start/End: Original strand, 16341254 - 16341413
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
167 |
Q |
| |
|
|||||||||||| ||||||| || |||||||||||||||||| |||||| |||||||||||||||||||||||||||| | ||||||||||||| | |
|
|
| T |
16341254 |
ggtaaagttgttatcatgtatttgaaaggtcacgggttcaagttctagaaacagcctcttgtgtaaaaaacagggtaaggctacgtacaatacaccaa-a |
16341352 |
T |
 |
| Q |
168 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctt |
228 |
Q |
| |
|
|||||||| || |||||| |||| |||||||||||||||| |||||||||| ||||||| |
|
|
| T |
16341353 |
atggtgggccctcttcccggacctatcatatgcgggagctttggtgcaccgggctgccctt |
16341413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 68 - 228
Target Start/End: Original strand, 29907393 - 29907552
Alignment:
| Q |
68 |
ggtaaagttgttgt--catgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaa |
165 |
Q |
| |
|
|||||||||||||| ||||| |||| |||||||||||||||||| |||||| |||||||||||||||| || |||||||||| | ||||||||||| |
|
|
| T |
29907393 |
ggtaaagttgttgtatcatgtgactgaaaggtcacgggttcaagtcctagaaacagcctcttgtgtaaaaaatagtgtaaggctgcgttcaatacaccaa |
29907492 |
T |
 |
| Q |
166 |
taatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctt |
228 |
Q |
| |
|
|||||||||||||| |||| ||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
29907493 |
-aatggtgggaccccatcccggaccctg--tatgcgggagctttagtgcaccgggttgccctt |
29907552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 62 - 228
Target Start/End: Original strand, 42476843 - 42477005
Alignment:
| Q |
62 |
gtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaataca |
161 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||||||||| ||||||| ||||||| ||||||||| |||||| ||||||||||| ||||||||| |
|
|
| T |
42476843 |
gtaactggtaaagttgttgtcatgtgactaaaaggtcacggattcaagttctggaaacagtctcttgtgt--aaaacaaggtaaggctgcgtacaataca |
42476940 |
T |
 |
| Q |
162 |
ccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctt |
228 |
Q |
| |
|
||| |||||||||||||||||| || | | ||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
42476941 |
cca--aatggtgggaccccttcctaggctctgcatatgcgggagctctagtgcaccaggttgccctt |
42477005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 68 - 229
Target Start/End: Complemental strand, 23419833 - 23419674
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
167 |
Q |
| |
|
|||||||||| |||||||| ||| |||||||| ||||||||| ||||||| ||||||||||||||||||||||||| |||| |||||||||||| | |
|
|
| T |
23419833 |
ggtaaagttgctgtcatgtgactaaaaggtcacaggttcaagttctggaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacca--a |
23419736 |
T |
 |
| Q |
168 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
||||||||||||||||| ||||| || | |||||| ||||||||||| |||| |||||||| |
|
|
| T |
23419735 |
atggtgggaccccttcctagaccttgcgtgtgcgggggctttagtgcatcgggctgcccttt |
23419674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 68 - 231
Target Start/End: Original strand, 19265791 - 19265950
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
167 |
Q |
| |
|
|||||||||||||||| || |||| |||||||||||||||||| ||| ||| || ||||||| ||||| ||||||||||||| |||||||||||| | |
|
|
| T |
19265791 |
ggtaaagttgttgtcacgtgactgaaaggtcacgggttcaagtcttggatacagccgcttgtgt-aaaaagagggtaaggctgcgtacaatacacca--a |
19265887 |
T |
 |
| Q |
168 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|||||||||||||||||| || || |||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
19265888 |
atggtgggaccccttcccgga-cctacatatgtgggagctttagtgcaccgggctgcccttttt |
19265950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 64 - 231
Target Start/End: Complemental strand, 34626370 - 34626206
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| | || |||| ||| | ||||||| ||||||| |||| |||||||||| |||||||||||||| | ||||||||| |
|
|
| T |
34626370 |
aactggtaaagttgttgtcatgtgattgaaaggccacagattcaagtcctggaaacagcctcctgtgtaaaaa-cagggtaaggctgcgttcaatacacc |
34626272 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|| ||||||||| |||||||| ||||| || ||||||||||||||||| || ||||||||||||||| |
|
|
| T |
34626271 |
aa--atggtgggatcccttcccggaccctgcgtatgcgggagctttagttcatcgggttgcccttttt |
34626206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 68 - 220
Target Start/End: Complemental strand, 28362304 - 28362155
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
167 |
Q |
| |
|
||||||||||||||||||| ||| |||||||| ||||||||| ||||| ||||||||||||||||| ||||||||||| |||||||||||| | |
|
|
| T |
28362304 |
ggtaaagttgttgtcatgtggctgaaaggtcacaggttcaagtcctagaaactgcctcttgtgtaaaaaacttggtaaggctgcgtacaatacacca--a |
28362207 |
T |
 |
| Q |
168 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
220 |
Q |
| |
|
||||||||||||||||||||||| ||||||| ||||||||| |||||||||| |
|
|
| T |
28362206 |
atggtgggaccccttcccagaccttgcatatgtgggagcttt-gtgcaccggg |
28362155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 83 - 231
Target Start/End: Complemental strand, 38262340 - 38262194
Alignment:
| Q |
83 |
atgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggacccctt |
182 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||| ||||||||||||||| | ||||| | |||||||||||||||| |||| ||||||||||| |
|
|
| T |
38262340 |
atgtgactggaaggtcacgggttcaagtcctggaaacagtctcttgtgtaaaaaatatggtaatgttgcatacaatacacca--aatgatgggacccctt |
38262243 |
T |
 |
| Q |
183 |
cccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
||| || | || |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
38262242 |
cccgaacactgcgtatgcgggagctttagtgcaccggattgcccttttt |
38262194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 64 - 231
Target Start/End: Complemental strand, 47078016 - 47077853
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||||| ||||||| ||||||||| |||| || |||| | ||| |||||||||| |
|
|
| T |
47078016 |
aactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagtctcttgtgt--aaaatagagtaaagttgcgtacaatacac- |
47077920 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
| |||||||||||||||||||| |||| |||||||||||||| ||||||||||| ||||| ||||| |
|
|
| T |
47077919 |
-aaaatggtgggaccccttcccaaaccctacatatgcgggagctctagtgcaccggattgcctttttt |
47077853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 93 - 227
Target Start/End: Complemental strand, 18512586 - 18512455
Alignment:
| Q |
93 |
aaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagacccc |
192 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||||||||| ||||||||||||| ||||||||||| | |||||||||||||||||| ||||| |
|
|
| T |
18512586 |
aaggtcacgggttcaagtcctggaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccga--atggtgggaccccttcccggaccct |
18512490 |
T |
 |
| Q |
193 |
gcatatgcgggagctttagtgcaccgggttgccct |
227 |
Q |
| |
|
|| |||||||||||||| |||||| |||||||||| |
|
|
| T |
18512489 |
gcgtatgcgggagctttggtgcactgggttgccct |
18512455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 93 - 230
Target Start/End: Complemental strand, 31591241 - 31591108
Alignment:
| Q |
93 |
aaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagacccc |
192 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||||| ||| |||||||||| ||||||||| || |||||||||||||||||| |||| |
|
|
| T |
31591241 |
aaggtcacgagttcaagtcctggaaacaacctcttgtgtaaaa--cagagtaaggctgcgtacaatacaataa--atggtgggaccccttcccggacctt |
31591146 |
T |
 |
| Q |
193 |
gcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
31591145 |
gcatatgcgggagctctagtgcaccgggttgccctttt |
31591108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 64 - 229
Target Start/End: Complemental strand, 14732985 - 14732821
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| |||| || |||| |||||||||| ||||||| |||| ||||||||||||||||||||||| | ||||||||| |
|
|
| T |
14732985 |
aactggtaaagttgttgtcatgtgactgaaaagtcatgggttcaagtcctggaaacagcctcccatgtaaaaaacagggtaaggctgcgt-caatacacc |
14732887 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
|| ||||||| || ||||||| |||| | |||||||||||||||||||||||| ||| ||||| |
|
|
| T |
14732886 |
aaaaatggtgaaactccttcccgaaccctgtttatgcgggagctttagtgcaccggattgtccttt |
14732821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 78 - 228
Target Start/End: Original strand, 18747472 - 18747621
Alignment:
| Q |
78 |
ttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaa-cagggtaaggctgcatacaatacaccaataatggtggga |
176 |
Q |
| |
|
|||||| || |||| ||||||||||| |||||| ||||||| ||| |||||||||||| |||||||||||||| || ||||||||||| |||||||| |
|
|
| T |
18747472 |
ttgtcacgtgactgaaaggtcacgggatcaagtcttggaaacagccttttgtgtaaaaaagcagggtaaggctgcgtataatacaccaat--tggtggga |
18747569 |
T |
 |
| Q |
177 |
ccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctt |
228 |
Q |
| |
|
|||||||| |||| || ||||||||||||||||||||||||| ||||||| |
|
|
| T |
18747570 |
ccccttcctgaaccctgcgtatgcgggagctttagtgcaccgggctgccctt |
18747621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 68 - 228
Target Start/End: Complemental strand, 3469338 - 3469176
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaa--cagggtaaggctgcatacaatacaccaa |
165 |
Q |
| |
|
||||||||||||||||||| |||| |||||||| | |||||| |||||| ||||||||||||||| ||||||| || ||| ||||||||||||| |
|
|
| T |
3469338 |
ggtaaagttgttgtcatgtgactgaaaggtcacagactcaagtcctagaaacattctcttgtgtaaaaaaaacagggtacggttgcgtacaatacaccaa |
3469239 |
T |
 |
| Q |
166 |
taatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctt |
228 |
Q |
| |
|
||||| |||||||||||| |||||| | ||||||||||||||||||| | ||||||||||| |
|
|
| T |
3469238 |
aaatggcgggaccccttcctagaccctgtgtatgcgggagctttagtgcgctgggttgccctt |
3469176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 75 - 231
Target Start/End: Complemental strand, 32233286 - 32233133
Alignment:
| Q |
75 |
ttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgg |
174 |
Q |
| |
|
||||||||| | |||| ||||||| |||||||||| ||||||||||||||||||||||| ||||||||||| || || | |||||||| ||||||| |
|
|
| T |
32233286 |
ttgttgtcacctgactgaaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaaa-cagggtaaggcagcgtatattacaccaa--atggtgg |
32233190 |
T |
 |
| Q |
175 |
gaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|| |||||||| |||| ||||||| |||||||| ||||||||||| |||||||||| |
|
|
| T |
32233189 |
gattccttcccaaaccctgcatatgagggagcttcagtgcaccgggctgcccttttt |
32233133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 96 - 220
Target Start/End: Original strand, 21566439 - 21566562
Alignment:
| Q |
96 |
gtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgca |
195 |
Q |
| |
|
||||| ||||||||| |||||| ||||||||||||||||||| | ||| |||| ||||||||||||| |||||| |||||||||||| |||| ||| |
|
|
| T |
21566439 |
gtcacaggttcaagtcttggaaaccgcctcttgtgtaaaaaacagaggaagactgcgtacaatacaccaa-aatggtaggaccccttcccgaaccctgca |
21566537 |
T |
 |
| Q |
196 |
tatgcgggagctttagtgcaccggg |
220 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
21566538 |
tatgcgggagctttagtgcaccggg |
21566562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 71 - 228
Target Start/End: Original strand, 11741774 - 11741927
Alignment:
| Q |
71 |
aaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatg |
170 |
Q |
| |
|
|||||||||||||||| |||| ||||||| |||||||||| | ||||| | ||| |||| |||| ||||||||||||| |||||||||||| |||| |
|
|
| T |
11741774 |
aaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctgaaaacagcttctagtgt--aaaatagggtaaggctgcgtacaatacacca--aatg |
11741869 |
T |
 |
| Q |
171 |
gtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctt |
228 |
Q |
| |
|
|||||| |||||||| || | ||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
11741870 |
gtgggatcccttcccggattctgcacatgcgggagctctagtgcaccgggttgccctt |
11741927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 64 - 170
Target Start/End: Complemental strand, 1424073 - 1423967
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||| ||||| | ||||||| || |||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
1424073 |
aactggtaaagttgttgttatgtgactggaaggtcacggattcaaatcctggaaacagtctgttgtgtaaaaaacagggtaatgctgcatacactacacc |
1423974 |
T |
 |
| Q |
164 |
aataatg |
170 |
Q |
| |
|
||||||| |
|
|
| T |
1423973 |
aataatg |
1423967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 68 - 205
Target Start/End: Complemental strand, 48123643 - 48123508
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
167 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||| |||||||||| ||||||| ||||||||||||| |||||||||| ||||||||||||||||| | |
|
|
| T |
48123643 |
ggtaaagttgttatcatgtgtctgaaaggtcatgggttcaagtcctggaaacagcctcttgtgtaaataacagggtaaaactgcatacaatacacca--a |
48123546 |
T |
 |
| Q |
168 |
atggtgggaccccttcccagaccccgcatatgcgggag |
205 |
Q |
| |
|
||||||||||||||| | |||| ||||||||||||| |
|
|
| T |
48123545 |
atggtgggacccctttctggaccatgcatatgcgggag |
48123508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 68 - 165
Target Start/End: Original strand, 12473280 - 12473377
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaa |
165 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||| |||||||||| | |||||||||||||||| ||||||||||||||| ||| ||||||||||||| |
|
|
| T |
12473280 |
ggtaaagttgttgtcatgtatctgaaaggtcatgggttcaagtcctgcaaacaacctcttgtgtcaaaaacagggtaaggatgcgtacaatacaccaa |
12473377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 68 - 208
Target Start/End: Original strand, 19266426 - 19266564
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
167 |
Q |
| |
|
||||||||||||||||||| |||| |||||| |||||||||| | ||| | || |||| |||||||||||||||||||||| |||||||||||| | |
|
|
| T |
19266426 |
ggtaaagttgttgtcatgtgactgaaaggtcgtgggttcaagtcctgaaaatagccacttgcgtaaaaaacagggtaaggctgcgtacaatacacca--a |
19266523 |
T |
 |
| Q |
168 |
atggtgggaccccttcccagaccccgcatatgcgggagctt |
208 |
Q |
| |
|
|| |||||| |||||||| ||||| || ||||||||||||| |
|
|
| T |
19266524 |
attgtgggatcccttcccggaccctgcgtatgcgggagctt |
19266564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 64 - 215
Target Start/End: Complemental strand, 5180320 - 5180169
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||| |||||||| | ||||||| |||||||||| |||||||||||||| ||| ||||| ||||| |
|
|
| T |
5180320 |
aactggtaaagttgttgtcatgtgactgaaaggtcaagggttcaacttctggaaacagcctcttgtgtcaaaaacagggtaagactgtgtacaacacacc |
5180221 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgca |
215 |
Q |
| |
|
|| |||| | ||||||||| ||| | || | ||||| ||||||||| |||| |
|
|
| T |
5180220 |
aaaaatgattggacccctttccaaatcctacgtatgcaggagctttaatgca |
5180169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 64 - 189
Target Start/End: Complemental strand, 8149109 - 8148985
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtg-taaaaaacagggtaaggctgcatacaatacac |
162 |
Q |
| |
|
||||||||| ||||||||||||| |||| || |||||| |||||||| | |||| |||||||||| ||||||| ||||||||| ||| |||||||||| |
|
|
| T |
8149109 |
aactggtaatgttgttgtcatgtgactgcaaagtcacgagttcaagtcctgaaaactacctcttgtgttaaaaaatagggtaaggttgcgtacaatacac |
8149010 |
T |
 |
| Q |
163 |
caataatggtgggaccccttcccagac |
189 |
Q |
| |
|
|| ||||||||||||||||||||||| |
|
|
| T |
8149009 |
ca--aatggtgggaccccttcccagac |
8148985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 68 - 185
Target Start/End: Complemental strand, 14099165 - 14099050
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
167 |
Q |
| |
|
||||||||||||||||||| |||| ||||||| ||||| |||| ||||| | ||| |||||||||||||||| |||| |||| |||||||||||| | |
|
|
| T |
14099165 |
ggtaaagttgttgtcatgtgactgaaaggtcatgggttgaagtcctggaaatagccttttgtgtaaaaaacaggttaagactgcgtacaatacacca--a |
14099068 |
T |
 |
| Q |
168 |
atggtgggaccccttccc |
185 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
14099067 |
atggtgggaccccttccc |
14099050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 68 - 185
Target Start/End: Complemental strand, 14409182 - 14409067
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
167 |
Q |
| |
|
||||||||||||||||||| |||| ||||||| ||||| |||| ||||| | ||| |||||||||||||||| |||| |||| |||||||||||| | |
|
|
| T |
14409182 |
ggtaaagttgttgtcatgtgactgaaaggtcatgggttgaagtcctggaaatagccttttgtgtaaaaaacaggttaagactgcgtacaatacacca--a |
14409085 |
T |
 |
| Q |
168 |
atggtgggaccccttccc |
185 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
14409084 |
atggtgggaccccttccc |
14409067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 64 - 150
Target Start/End: Original strand, 18327006 - 18327091
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctg |
150 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||||||||||||||||| ||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
18327006 |
aactggtaaagttgttgtcatgtgacttgaaggtcacgggttcaagtcccggaaacagcctcttgtgt-aaaaacagggtaaggctg |
18327091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 67 - 230
Target Start/End: Original strand, 39123865 - 39124031
Alignment:
| Q |
67 |
tggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggta----aggctgcatacaatacac |
162 |
Q |
| |
|
|||||||||||||||||||| |||| || | ||||||||||||| ||||| |||||||||||||| ||||||| ||||||| || ||||||| |
|
|
| T |
39123865 |
tggtaaagttgttgtcatgtgactgaaacgacacgggttcaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacac |
39123963 |
T |
 |
| Q |
163 |
caataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
||| ||||||||||||||||||| ||||| || |||| ||||||||| ||||||| | ||||||||| |
|
|
| T |
39123964 |
caaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccaagctgccctttt |
39124031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 67 - 184
Target Start/End: Original strand, 7644931 - 7645047
Alignment:
| Q |
67 |
tggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaat |
166 |
Q |
| |
|
||||||| ||||||| | || |||| |||||||||||||||||| ||||||| ||||||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
7644931 |
tggtaaatttgttgtaacgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaagatagcgtacaatacaccaa- |
7645029 |
T |
 |
| Q |
167 |
aatggtgggaccccttcc |
184 |
Q |
| |
|
||| |||||||||||||| |
|
|
| T |
7645030 |
aattgtgggaccccttcc |
7645047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 67 - 231
Target Start/End: Original strand, 13805077 - 13805237
Alignment:
| Q |
67 |
tggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaat |
166 |
Q |
| |
|
|||||||||||||||||||| |||| ||||| |||||||||||| ||||| | ||||| |||||||| | ||||||||||| |||||||||||| |
|
|
| T |
13805077 |
tggtaaagttgttgtcatgtgactgaaaggtaacgggttcaagtcctggaaatagcctctggtgtaaaaca-ggggtaaggctgtgtacaatacacca-- |
13805173 |
T |
 |
| Q |
167 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|||||||||||| ||||| ||||| || |||||||||||||| |||||| ||| | |||||||| |
|
|
| T |
13805174 |
aatggtgggaccacttcctggaccctgcgtatgcgggagcttt-gtgcactgggctacccttttt |
13805237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 114 - 221
Target Start/End: Original strand, 38604549 - 38604654
Alignment:
| Q |
114 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagcttt-agt |
212 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||||||| |||||||||||| ||||||| |||||||| || ||||| || |||||||||||||| ||| |
|
|
| T |
38604549 |
ggaaacagcctcttgtgtaaaa-acagggtaaggctgcgtacaatacacca--aatggtgagacccctttccggaccctgcgtatgcgggagctttaagt |
38604645 |
T |
 |
| Q |
213 |
gcaccgggt |
221 |
Q |
| |
|
||||||||| |
|
|
| T |
38604646 |
gcaccgggt |
38604654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 144 - 231
Target Start/End: Complemental strand, 27889399 - 27889314
Alignment:
| Q |
144 |
aaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||||| ||||| || |||||||||||||| || |||||||||||||||||| |
|
|
| T |
27889399 |
aaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgcgggagctttggtacaccgggttgcccttttt |
27889314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 72 - 210
Target Start/End: Complemental strand, 28078286 - 28078151
Alignment:
| Q |
72 |
aagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatgg |
171 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||| |||||| ||| ||| |||||||||||||||| ||||| |||||||||| ||||| |
|
|
| T |
28078286 |
aagttgttgtcatgtgactgtaaggtcacgggttcaagtcctagaaacagtctcgtgta-aaaaaacagggtaaggttgcatgcaatacacca--aatgg |
28078190 |
T |
 |
| Q |
172 |
tgggaccccttcccagaccccgcatatgcgggagcttta |
210 |
Q |
| |
|
|||||||||||||| | || ||||||||| |||||||| |
|
|
| T |
28078189 |
tgggaccccttcccgaatcctgcatatgcgagagcttta |
28078151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 64 - 219
Target Start/End: Complemental strand, 2663094 - 2662946
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
|||| ||||||||||||| |||| |||||| |||| ||||||||| ||||||| |||||||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
2663094 |
aactagtaaagttgttgttatgtgactgga--gtcataggttcaagtcctggaaacagcctcttgtgtaaaata--gggtaaggctgcgtacaatacacc |
2662999 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgg |
219 |
Q |
| |
|
| |||||||||| ||||| ||||||| ||||||||||||||| ||| ||||||| |
|
|
| T |
2662998 |
a--aatggtggga-cccttttcagaccctgcatatgcgggagctctagcgcaccgg |
2662946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 117 - 230
Target Start/End: Complemental strand, 35787378 - 35787268
Alignment:
| Q |
117 |
aacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcac |
216 |
Q |
| |
|
|||| ||||||||||||||| || ||||||| ||| ||||||||||||| |||| ||||||||||||| |||| || ||||||||||||| | ||||| |
|
|
| T |
35787378 |
aacagcctcttgtgtaaaaa-catggtaaggttgcgtacaatacaccaa--atggcgggaccccttcccggaccttgcgtatgcgggagcttcaatgcac |
35787282 |
T |
 |
| Q |
217 |
cgggttgccctttt |
230 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
35787281 |
cgggttgccctttt |
35787268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 62 - 150
Target Start/End: Original strand, 7193055 - 7193143
Alignment:
| Q |
62 |
gtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctg |
150 |
Q |
| |
|
|||||| |||||||||||||||||| |||| |||||||||||||||||| |||||||||||||||||||| || | |||||||||| |
|
|
| T |
7193055 |
gtaacttgtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctcgaaacaacctcttgtgtaaacaatatggtaaggctg |
7193143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 64 - 149
Target Start/End: Complemental strand, 7794669 - 7794582
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgt--aaaaaacagggtaaggct |
149 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||||||||||| ||||||| |||||| ||| |||||||||||||||||| |
|
|
| T |
7794669 |
aactggtaaagttgttgttatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttatgtaaaaaaaacagggtaaggct |
7794582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 93 - 184
Target Start/End: Original strand, 35203440 - 35203531
Alignment:
| Q |
93 |
aaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcc |
184 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||||||||||| |||| |||| ||||||| ||||| |||||||||| ||||||| |
|
|
| T |
35203440 |
aaggtcacgggttcaagtcctggaaacattctcttgtgtaaaaaacaggataagactgcgtacaatataccaaaaatggtgggatcccttcc |
35203531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 122 - 231
Target Start/End: Original strand, 1408487 - 1408594
Alignment:
| Q |
122 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
221 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||| ||| |||||||||||||||||| ||||| || ||||| | | ||||||| |||||| | |
|
|
| T |
1408487 |
cctcttgtgtaaaaaacaaggtaaggctgtgtacaatacagcaa--atggtgggaccccttcccggaccctgcgtatgcagaatctttagttcaccggat |
1408584 |
T |
 |
| Q |
222 |
tgcccttttt |
231 |
Q |
| |
|
|||| ||||| |
|
|
| T |
1408585 |
tgcctttttt |
1408594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 69 - 165
Target Start/End: Original strand, 6736867 - 6736962
Alignment:
| Q |
69 |
gtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaa |
165 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||||| |||||||||||||| | ||||||| |||||| |||||||||||||||||| |
|
|
| T |
6736867 |
gtaaagttgttgtcatgcgactgaaaggtcacgggttcaagtcctcaaaacaacctcttgtat-aaaaacaaggtaagactgcatacaatacaccaa |
6736962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 144 - 229
Target Start/End: Complemental strand, 45019010 - 45018923
Alignment:
| Q |
144 |
aaggctgcatacaatacaccaataa--tggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
|||||||| ||||||| ||||| || |||||| |||||||||| ||||| || |||||||||||||||||||||| ||||||||||| |
|
|
| T |
45019010 |
aaggctgcgtacaatataccaaaaaactggtggaaccccttcccggaccctgcgtatgcgggagctttagtgcaccaggttgcccttt |
45018923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 64 - 147
Target Start/End: Complemental strand, 42495998 - 42495916
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaagg |
147 |
Q |
| |
|
||||||||||||||||||||| | |||| |||||||||||||||||| ||||||| |||||||| | ||||||||||||||| |
|
|
| T |
42495998 |
aactggtaaagttgttgtcatatgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtat-aaaaacagggtaagg |
42495916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 68 - 214
Target Start/End: Complemental strand, 42102044 - 42101899
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
167 |
Q |
| |
|
|||||||||||||||| || |||||||||||| |||||||| ||||||| |||||| |||||||||||||||| |||| |||| ||| | || | |
|
|
| T |
42102044 |
ggtaaagttgttgtcacgtgactggaaggtcaaaagttcaagtcctggaaacagcctcttccgtaaaaaacagggtaacactgcgtacagtactctaa-a |
42101946 |
T |
 |
| Q |
168 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgc |
214 |
Q |
| |
|
||||||||||| ||||| ||||| || ||| ||| ||||||||||| |
|
|
| T |
42101945 |
gtggtgggaccctttcccggaccctgcgtatccggcagctttagtgc |
42101899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 68 - 149
Target Start/End: Original strand, 5814447 - 5814528
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggct |
149 |
Q |
| |
|
|||||||||||||| |||| | ||||| ||||||||||||||| ||||| |||||||| ||||||||| ||||||||||| |
|
|
| T |
5814447 |
ggtaaagttgttgttatgtgattggaaagtcacgggttcaagttttggaaagaacctcttatgtaaaaaatagggtaaggct |
5814528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 182 - 231
Target Start/End: Original strand, 36602535 - 36602584
Alignment:
| Q |
182 |
tcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
36602535 |
tcccagaccctgcgtatgcgggagctttagtgcaccgggttgcccttttt |
36602584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 135 - 232
Target Start/End: Complemental strand, 39093532 - 39093436
Alignment:
| Q |
135 |
aaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttta |
232 |
Q |
| |
|
|||||||||||| ||| |||||||||||| |||| |||||| |||||||| || | |||||||| | ||||||||||||||||| ||||||||||| |
|
|
| T |
39093532 |
aaacagggtaagactgtgtacaatacacca-taatagtgggaacccttcccggaacttgcatatgcagaagctttagtgcaccgggctgcccttttta |
39093436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 128 - 232
Target Start/End: Complemental strand, 13792250 - 13792147
Alignment:
| Q |
128 |
gtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccct |
227 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||| | ||||| ||||||||||| | |||| || ||||| |||||||| |||||||| | |||||| |
|
|
| T |
13792250 |
gtgtaaaaaacttggtaagactgcatacaatacaccca-aatggcgggaccccttctcgaaccctgcgtatgctggagcttttgtgcaccgagctgccct |
13792152 |
T |
 |
| Q |
228 |
tttta |
232 |
Q |
| |
|
||||| |
|
|
| T |
13792151 |
tttta |
13792147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 122 - 229
Target Start/End: Original strand, 23231587 - 23231692
Alignment:
| Q |
122 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
221 |
Q |
| |
|
|||||||||||||| | | ||||||||||| || |||||||| | ||| |||||||||||||| |||| || ||||||| ||||||||||||||| || |
|
|
| T |
23231587 |
cctcttgtgtaaaatataaggtaaggctgcgtataatacaccga--atgatgggaccccttcccgaaccctgcgtatgcggcagctttagtgcaccgagt |
23231684 |
T |
 |
| Q |
222 |
tgcccttt |
229 |
Q |
| |
|
| |||||| |
|
|
| T |
23231685 |
ttcccttt |
23231692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 135 - 226
Target Start/End: Original strand, 33500556 - 33500645
Alignment:
| Q |
135 |
aaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccc |
226 |
Q |
| |
|
|||||||||||| |||| ||| |||||| || ||||||||||||||||||| ||||| || ||||||||| ||| |||| ||||||||||| |
|
|
| T |
33500556 |
aaacagggtaagactgcgtactatacacaaaaaatggtgggaccccttcccggaccctgcgtatgcgggatcttcagtg--ccgggttgccc |
33500645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 64 - 138
Target Start/End: Original strand, 21447562 - 21447636
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaac |
138 |
Q |
| |
|
||||| |||| |||||||||||||| ||||||||||||| ||||||| | ||||| ||||||||||||||||| |
|
|
| T |
21447562 |
aactgataaatttgttgtcatgtaattggaaggtcacggattcaagtcttgaaaacagcctcttgtgtaaaaaac |
21447636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 114 - 227
Target Start/End: Original strand, 27697459 - 27697572
Alignment:
| Q |
114 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggt--gggacccctt-cccagaccccgcatatgcgggagcttta |
210 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||| | |||||||||| |||||| ||||||| || ||||||||| || ||||||||||||| | |
|
|
| T |
27697459 |
ggaaacaacctcttgtgtaaaaatcagggcaaggctg--tgtaatacaccaa-aatggtgggggaccctttccccagaccctgcgtatgcgggagcttaa |
27697555 |
T |
 |
| Q |
211 |
gtgcaccgggttgccct |
227 |
Q |
| |
|
||||||||| |||||| |
|
|
| T |
27697556 |
atgcaccgggatgccct |
27697572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 167 - 232
Target Start/End: Complemental strand, 23619039 - 23618974
Alignment:
| Q |
167 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttta |
232 |
Q |
| |
|
||||||||||||||||| |||||| || | ||| |||||||||||||| |||||||||||||||| |
|
|
| T |
23619039 |
aatggtgggaccccttcgcagaccttgcgtttgcaggagctttagtgcagcgggttgcccttttta |
23618974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 67 - 159
Target Start/End: Original strand, 22065563 - 22065654
Alignment:
| Q |
67 |
tggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaata |
159 |
Q |
| |
|
||||||||||||||||| || | || || |||| | |||||||| |||||||||||||||||| ||||| ||||||| ||||||||||||| |
|
|
| T |
22065563 |
tggtaaagttgttgtcacgtgattgaaaagtcatgagttcaagttttggaaacaacctcttgtgt-aaaaatagggtaaagctgcatacaata |
22065654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 68 - 164
Target Start/End: Complemental strand, 44123780 - 44123685
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacca |
164 |
Q |
| |
|
|||||||||| |||||||| |||| ||| | |||||||||||| ||||||| ||||||||||| |||||| ||||||| ||||| ||||||||| |
|
|
| T |
44123780 |
ggtaaagttggtgtcatgtgactgaaagattacgggttcaagtactggaaacagcctcttgtgta-aaaacaaggtaaggttgcatgaaatacacca |
44123685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 167 - 231
Target Start/End: Original strand, 45811920 - 45811983
Alignment:
| Q |
167 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|||||||||| ||||| |||||||| || ||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
45811920 |
aatggtgggatccctttccagaccctgcttatgcaggagctttagtgca-cgggttgcccttttt |
45811983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 64 - 149
Target Start/End: Complemental strand, 29140523 - 29140438
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggct |
149 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| ||||||| | |||||| ||||| |||||||| | ||||||||| |
|
|
| T |
29140523 |
aactggtaaagttgttgtcatgtaactgaaaggtcacacattcaagttttgaaaacaatctcttaggtaaaaaataaggtaaggct |
29140438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 198 - 231
Target Start/End: Complemental strand, 44171668 - 44171635
Alignment:
| Q |
198 |
tgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
44171668 |
tgcgggagctttagtgcaccgggttgcccttttt |
44171635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 129 - 185
Target Start/End: Complemental strand, 17048914 - 17048859
Alignment:
| Q |
129 |
tgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttccc |
185 |
Q |
| |
|
||||||||||||||||||| | | ||||||||||||| |||||||| |||||||||| |
|
|
| T |
17048914 |
tgtaaaaaacagggtaaggttacgtacaatacaccaa-aatggtggaaccccttccc |
17048859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 123 - 230
Target Start/End: Complemental strand, 23066029 - 23065924
Alignment:
| Q |
123 |
ctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggtt |
222 |
Q |
| |
|
||||||| ||||||||||| ||| | ||| |||||||||||| ||| ||||| ||||| || | || ||||||| ||||||||| ||||||||| || |
|
|
| T |
23066029 |
ctcttgtttaaaaaacaggataaagttgcgtacaatacacca--tatgatgggatccctttccgaatcctgcatatgtgggagctttggtgcaccggatt |
23065932 |
T |
 |
| Q |
223 |
gccctttt |
230 |
Q |
| |
|
|||||||| |
|
|
| T |
23065931 |
gccctttt |
23065924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 167 - 231
Target Start/End: Original strand, 25198799 - 25198863
Alignment:
| Q |
167 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|||||| ||| |||||||||||||| | |||| | |||||||||||||||||||||| |||||| |
|
|
| T |
25198799 |
aatggtaggatcccttcccagacccttcgtatgtgagagctttagtgcaccgggttgcacttttt |
25198863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 123 - 218
Target Start/End: Original strand, 25434050 - 25434144
Alignment:
| Q |
123 |
ctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
218 |
Q |
| |
|
|||||||| |||||||| |||||| ||||||||| ||||||| |||||| ||| |||| ||||| || ||||||||||||||||||||||| |
|
|
| T |
25434050 |
ctcttgtgcaaaaaacatggtaagagtgcatacaacacaccaa-aatggtatgacttcttcttggaccctgcgtatgcgggagctttagtgcaccg |
25434144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 123 - 216
Target Start/End: Complemental strand, 21139851 - 21139761
Alignment:
| Q |
123 |
ctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcac |
216 |
Q |
| |
|
|||||||||||||| ||| |||||| || ||||| |||||||| |||||||||||||||||| || | | ||||||| ||||||||||||| |
|
|
| T |
21139851 |
ctcttgtgtaaaaa-cagagtaaggttggatacagtacaccaa--atggtgggaccccttcccgaactctgtgtatgcggaagctttagtgcac |
21139761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 178 - 226
Target Start/End: Complemental strand, 42495913 - 42495865
Alignment:
| Q |
178 |
cccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccc |
226 |
Q |
| |
|
|||||||| ||||| || |||||||||||||||||||||| ||||||| |
|
|
| T |
42495913 |
cccttcccggaccctgcgtatgcgggagctttagtgcaccccgttgccc |
42495865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 136; Significance: 8e-71; HSPs: 84)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 136; E-Value: 8e-71
Query Start/End: Original strand, 64 - 231
Target Start/End: Complemental strand, 13730767 - 13730600
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
13730767 |
aactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgtgtacaatacacc |
13730668 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13730667 |
aataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
13730600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 121; E-Value: 7e-62
Query Start/End: Original strand, 64 - 231
Target Start/End: Complemental strand, 40272975 - 40272810
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
40272975 |
aactggtaaagttgttgtcatgtgactggaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaaggctgcgtacaatacacc |
40272876 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
| ||||||||||||||||||| ||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
40272875 |
a--aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttttt |
40272810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 116; E-Value: 7e-59
Query Start/End: Original strand, 71 - 230
Target Start/End: Complemental strand, 13628948 - 13628789
Alignment:
| Q |
71 |
aaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatg |
170 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||| ||||||| |||||||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
13628948 |
aaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaagaaacagggtaaggctgcgtacaatacaccaataatg |
13628849 |
T |
 |
| Q |
171 |
gtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
||||||||||||||| ||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
13628848 |
gtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
13628789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 62 - 230
Target Start/End: Complemental strand, 29366887 - 29366719
Alignment:
| Q |
62 |
gtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaataca |
161 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||||||||||||||||| ||||||| |||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
29366887 |
gtaactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaacagggtaaggctgcgtacaataca |
29366788 |
T |
 |
| Q |
162 |
ccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
|||||||||||||||||||||||| ||||| || |||| |||||||||||||||| ||||||||||||| |
|
|
| T |
29366787 |
ccaataatggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcactgggttgccctttt |
29366719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 64 - 231
Target Start/End: Complemental strand, 46421200 - 46421032
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
46421200 |
aactggtaaagttgttgtcatgtgacttaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacacc |
46421101 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagcttt-agtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|||||||||||||||||||||| ||||| || |||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
46421100 |
aataatggtgggaccccttcccggaccctgcgtatgcgggagctttaagtgcaccggtttgcccttttt |
46421032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 64 - 227
Target Start/End: Complemental strand, 8247852 - 8247688
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||||| ||||||| |||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
8247852 |
aactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggttgcgtacaatacacc |
8247753 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagcttt-agtgcaccgggttgccct |
227 |
Q |
| |
|
|||||||||||||| ||||||| ||||| || |||||||||||||| ||||||| |||||||||| |
|
|
| T |
8247752 |
aataatggtgggactccttcccggaccctgcgtatgcgggagctttaagtgcactgggttgccct |
8247688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 114 - 231
Target Start/End: Complemental strand, 49013588 - 49013471
Alignment:
| Q |
114 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
213 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
49013588 |
ggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatacgcgggagctttagtg |
49013489 |
T |
 |
| Q |
214 |
caccgggttgcccttttt |
231 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
49013488 |
caccgggttgcccttttt |
49013471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 64 - 232
Target Start/End: Original strand, 1217084 - 1217248
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||| ||||||| |||| |||||||||||||||||| ||||||| |||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
1217084 |
aactggtaaagttgtagtcatgtcactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacacc |
1217181 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttta |
232 |
Q |
| |
|
|| |||| ||||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1217182 |
aa--atggcgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttttta |
1217248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 64 - 212
Target Start/End: Original strand, 9607197 - 9607345
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
|||| |||||||||||||||||| |||| ||||||| ||||||||| ||||||| ||||||| |||||||||||||||||||||| || |||||||| |
|
|
| T |
9607197 |
aacttgtaaagttgttgtcatgtgactgaaaggtcatcggttcaagtcctggaaacagcctcttgcgtaaaaaacagggtaaggctgcgtagaatacacc |
9607296 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagt |
212 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9607297 |
aataatgttgggaccccttcccagaccccgcatatgcgggagctttagt |
9607345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 68 - 232
Target Start/End: Complemental strand, 53996725 - 53996562
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
167 |
Q |
| |
|
|||||| |||||||||| | |||| ||||||||| |||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| | |
|
|
| T |
53996725 |
ggtaaatttgttgtcatttgactgaaaggtcacgtgttcaagtcgtggaaacaacctcttgtgtaaaaaacagggtaaggctgcttacaatacaccaa-a |
53996627 |
T |
 |
| Q |
168 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttta |
232 |
Q |
| |
|
|||||||||||||||||| ||| | || |||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
53996626 |
atggtgggaccccttccctgacactgcgtatgtgggagctttagtgcaccgggctgcccttttta |
53996562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 71 - 231
Target Start/End: Complemental strand, 5173876 - 5173717
Alignment:
| Q |
71 |
aaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatg |
170 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||| ||||||||||||||||||||||| || |||||| ||||| ||||||||||| |||| |
|
|
| T |
5173876 |
aaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaa-caaagtaaggttgcatgcaatacaccaaaaatg |
5173778 |
T |
 |
| Q |
171 |
gtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
||||| ||||||||| |||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
5173777 |
gtggggccccttcccggaccttgcgtatgcgggagctttagtgcaccgggttgcccttttt |
5173717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 128 - 227
Target Start/End: Complemental strand, 353450 - 353351
Alignment:
| Q |
128 |
gtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccct |
227 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
353450 |
gtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccct |
353351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 64 - 230
Target Start/End: Complemental strand, 12914198 - 12914034
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
|||||||||||||||||| |||| || | |||||||| |||||||| ||||||| ||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
12914198 |
aactggtaaagttgttgtaatgtgaccgaaaggtcacaagttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggcggcgtacaatacacc |
12914099 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
| ||||||| ||||||||||||||||| |||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
12914098 |
a--aatggtgagaccccttcccagaccctgcatatgcgggagcttcaatgcaccgggttgccctttt |
12914034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 91; E-Value: 6e-44
Query Start/End: Original strand, 78 - 231
Target Start/End: Original strand, 516417 - 516571
Alignment:
| Q |
78 |
ttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc-aataatggtggga |
176 |
Q |
| |
|
||||||||| |||| |||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |||||| ||| || ||||| |||| |
|
|
| T |
516417 |
ttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgcacaataaaccaaaaaatggcggga |
516516 |
T |
 |
| Q |
177 |
ccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
||||||||| ||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
516517 |
ccccttccccgaccctgcgtatgcgggagctttagtgcaccgggttgcccttttt |
516571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 68 - 228
Target Start/End: Original strand, 22609764 - 22609921
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
167 |
Q |
| |
|
||||||||||||||||||| |||| ||||| |||||||||||| ||||||| ||||||||||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
22609764 |
ggtaaagttgttgtcatgtgactgtaaggtaacgggttcaagtcttggaaacagcctcttgtgtaaaaa-cagggtaaggctgcgtacaatacaccaa-- |
22609860 |
T |
 |
| Q |
168 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctt |
228 |
Q |
| |
|
|||||||||||||||||| |||| || ||||||||||||| ||||||||||||||||||| |
|
|
| T |
22609861 |
atggtgggaccccttcccggaccttgcgtatgcgggagcttcagtgcaccgggttgccctt |
22609921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 64 - 231
Target Start/End: Original strand, 26869701 - 26869865
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||| ||||||||| ||||||| ||||| |||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
26869701 |
aactggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagcctctggtgt-aaaaacagggtaaggctgcgtacaatacacc |
26869799 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
| |||||||||||||||| || |||| || |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26869800 |
a--aatggtgggaccccttgccggaccatgcgtatgcgggagctttggtgcaccgggttgcccttttt |
26869865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 114 - 229
Target Start/End: Original strand, 14987001 - 14987116
Alignment:
| Q |
114 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
213 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| |||| ||||||||||||||||||||| |
|
|
| T |
14987001 |
ggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggacccattcccggaccttgcatatgcgggagctttagtg |
14987100 |
T |
 |
| Q |
214 |
caccgggttgcccttt |
229 |
Q |
| |
|
||||||||| |||||| |
|
|
| T |
14987101 |
caccgggtttcccttt |
14987116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 69 - 232
Target Start/End: Complemental strand, 34420802 - 34420640
Alignment:
| Q |
69 |
gtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataa |
168 |
Q |
| |
|
||||||||||||||| || |||| |||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| ||| ||||||||| || |
|
|
| T |
34420802 |
gtaaagttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtaccatacaccaa-aa |
34420704 |
T |
 |
| Q |
169 |
tggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttta |
232 |
Q |
| |
|
||||||||||||||||| |||| || |||| |||||||||||||||| || ||||||||||| |
|
|
| T |
34420703 |
tggtgggaccccttcccggaccttgcgtatgtgggagctttagtgcacatggctgcccttttta |
34420640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 64 - 229
Target Start/End: Original strand, 39203510 - 39203671
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
|||| |||||||||||||||||| |||| |||||||| ||||||||| |||||| |||||||||||||| |||||||||| ||| ||||||||||| |
|
|
| T |
39203510 |
aacttgtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtccttgaaacagcctcttgtgtaaaa--cagggtaaggttgcgtacaatacacc |
39203607 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
|| |||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39203608 |
aa--atggtgggaccccttcccggaccttgcatatgcgggagctttagtgcaccgggttgcccttt |
39203671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 81 - 228
Target Start/End: Complemental strand, 45139624 - 45139479
Alignment:
| Q |
81 |
tcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggacccc |
180 |
Q |
| |
|
|||||| |||| |||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45139624 |
tcatgtgactgaaaggtcacgggttcaagttttggaaacaacctcttgtgtaaaacacagggtaaggctgcatacaatacaccaaaaatggtgggacccc |
45139525 |
T |
 |
| Q |
181 |
ttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctt |
228 |
Q |
| |
|
|||||||| || || ||||||||| |||| |||||||||| ||||||| |
|
|
| T |
45139524 |
ttcccaga-cctgcgtatgcgggaacttt-gtgcaccgggctgccctt |
45139479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 86; E-Value: 6e-41
Query Start/End: Original strand, 65 - 228
Target Start/End: Complemental strand, 22123077 - 22122918
Alignment:
| Q |
65 |
actggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacca |
164 |
Q |
| |
|
||||||||| |||||||||||| |||| |||||| ||||||||||| ||||||| ||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
22123077 |
actggtaaatttgttgtcatgtgactgaaaggtcgcgggttcaagtcctggaaacagtctcttgtgtaaaa--cagggtaaggctgcgtacaatacacca |
22122980 |
T |
 |
| Q |
165 |
ataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctt |
228 |
Q |
| |
|
| |||||||||||||||||| ||||| ||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
22122979 |
a--atggtgggaccccttcccggaccctgcatatgcgagagctctagtgcaccgggttgccctt |
22122918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 68 - 227
Target Start/End: Original strand, 26573125 - 26573282
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
167 |
Q |
| |
|
|||||||||||||||| || |||| |||||||||||||||||| ||||||| |||| ||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
26573125 |
ggtaaagttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacagcctcctgtgtaaaaaacagggtaaggctgcgtacaatacaccaat- |
26573223 |
T |
 |
| Q |
168 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccct |
227 |
Q |
| |
|
|||||||||||| |||| ||||| || |||||| ||||||||||||||| || |||||| |
|
|
| T |
26573224 |
-tggtgggaccccatcccggaccctgcgtatgcgtgagctttagtgcaccaggctgccct |
26573282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 84; E-Value: 9e-40
Query Start/End: Original strand, 64 - 218
Target Start/End: Complemental strand, 6411984 - 6411833
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| |||||||||| | ||||| ||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
6411984 |
aactggtaaagttgttgtcatgtaactgataggtcatgggttcaagtcttgtaaacagcctcttgtgta-aaaacagggtaaggctgcgtacaatacacc |
6411886 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
218 |
Q |
| |
|
| |||| ||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
6411885 |
a--aatgatgggaccccttcccagaccttgcgtatgcgggagctttagtgcaccg |
6411833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 116 - 229
Target Start/End: Complemental strand, 45786327 - 45786214
Alignment:
| Q |
116 |
aaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgca |
215 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| ||||| || |||| |||||||||||||| |
|
|
| T |
45786327 |
aaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgaatgctggagctttagtgca |
45786228 |
T |
 |
| Q |
216 |
ccgggttgcccttt |
229 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
45786227 |
ccgggttgcccttt |
45786214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 91 - 219
Target Start/End: Complemental strand, 45948974 - 45948848
Alignment:
| Q |
91 |
ggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagacc |
190 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||| | |||| |
|
|
| T |
45948974 |
ggaaggtcacgggttcaattcctggaaacaacctcttgtgtaaaaaatagggtaaggctgcatacaatacaccaat--tggtgggaccccttctcggacc |
45948877 |
T |
 |
| Q |
191 |
ccgcatatgcgggagctttagtgcaccgg |
219 |
Q |
| |
|
| || |||||||||||||||||||||||| |
|
|
| T |
45948876 |
ctgcgtatgcgggagctttagtgcaccgg |
45948848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 64 - 231
Target Start/End: Complemental strand, 52926373 - 52926217
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| ||||||||||| |||||||||| ||||||||||| |
|
|
| T |
52926373 |
aactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgta---------gtaaggctgcgtacaatacacc |
52926283 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|| |||||||||| ||||||| ||||| || |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
52926282 |
aa--atggtgggacaccttcccggaccctgcgtatgcgggagctttagcgcaccgggttgcccttttt |
52926217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 98 - 229
Target Start/End: Complemental strand, 10795554 - 10795423
Alignment:
| Q |
98 |
cacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcata |
197 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||| ||||||||||||||| ||||||||||||| |||||||||||||||||| ||||| || || |
|
|
| T |
10795554 |
cacgggttcaagtcctggaaacagcctcttgtgtaaaagacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcctggaccctgcgta |
10795455 |
T |
 |
| Q |
198 |
tgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| |
|
|
| T |
10795454 |
tgcgggagcttcagtgcaccaggttgcccttt |
10795423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 88 - 231
Target Start/End: Complemental strand, 54374485 - 54374343
Alignment:
| Q |
88 |
actggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccag |
187 |
Q |
| |
|
|||| |||||||| ||||||||| |||||||||||||||||||||||| ||||||||||||| |||||| |||||| ||||||||||||||||||| | |
|
|
| T |
54374485 |
actgaaaggtcacaggttcaagtcttggaaacaacctcttgtgtaaaaaatagggtaaggctgcgtacaatccaccaa-aatggtgggaccccttcccgg |
54374387 |
T |
 |
| Q |
188 |
accccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|||| |||||||||||||||||||| |||| || |||| ||||| |
|
|
| T |
54374386 |
accctgcatatgcgggagctttagttcaccaggctgccattttt |
54374343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 114 - 232
Target Start/End: Original strand, 54484734 - 54484851
Alignment:
| Q |
114 |
ggaaacaacctcttgtgtaaaaaa-cagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagt |
212 |
Q |
| |
|
||||||| |||||||||||||||| || ||||||||||| ||||||||||||| |||||||||||||||||| ||||| || ||||||||||||||||| |
|
|
| T |
54484734 |
ggaaacagcctcttgtgtaaaaaaacaaggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgcgggagctttagt |
54484831 |
T |
 |
| Q |
213 |
gcaccgggttgcccttttta |
232 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
54484832 |
gcaccgggttgcccttttta |
54484851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 73 - 231
Target Start/End: Original strand, 7942993 - 7943149
Alignment:
| Q |
73 |
agttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggt |
172 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||| ||||||| | |||||| |||||||||||||||| |||| ||||||||| || |||||| |
|
|
| T |
7942993 |
agttgttgtcatgtgactggaaggtcacggattcaagtcctggaaacagcatcttgtctaaaaaacagggtaagactgcgtacaatacatca--aatggt |
7943090 |
T |
 |
| Q |
173 |
gggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|||| ||||| ||||||| || ||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
7943091 |
gggatccctttccagaccatgcgtatgcgggagctttagtgcactgggttgcctttttt |
7943149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 64 - 230
Target Start/End: Original strand, 16735435 - 16735598
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| |||| || ||||||||||||||| |||||| |||||||| ||||| |||||||||||||| ||||||||||| |
|
|
| T |
16735435 |
aactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaaggctgcgtacaatacacc |
16735533 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
|| |||||||||||||||||| ||| | || ||||||| ||||| ||||||| ||||||||||||| |
|
|
| T |
16735534 |
aa--atggtgggaccccttcccggacactgcgtatgcggtagcttcagtgcactgggttgccctttt |
16735598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 99 - 229
Target Start/End: Original strand, 31592878 - 31593004
Alignment:
| Q |
99 |
acgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatat |
198 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||| |||||||||||||| ||||||||||||| |||||||||| ||||||| ||||| |||||| |
|
|
| T |
31592878 |
acgggttcaagtcctggaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggactccttcccggaccctgcatat |
31592973 |
T |
 |
| Q |
199 |
gcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |
|
|
| T |
31592974 |
gcgggagctctagtgcaccgggttgcccttt |
31593004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 64 - 231
Target Start/End: Complemental strand, 4495827 - 4495674
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| | ||| | ||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4495827 |
aactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctgaaaatagcctattgtgtaaaaaacagggtaaggctgcgtacaatacacc |
4495728 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
| |||||||| ||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
4495727 |
a--aatggtgg------------gaccctgcgtatgcgggagctttagtgcaccgggttgcccttttt |
4495674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 69 - 231
Target Start/End: Original strand, 25944468 - 25944629
Alignment:
| Q |
69 |
gtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataa |
168 |
Q |
| |
|
||||||||||||||| || |||| ||||||| |||||||||| |||||| ||||| ||||||||||| ||| ||||||| ||||||||||||| || |
|
|
| T |
25944468 |
gtaaagttgttgtcacgtgactgaaaggtcatgggttcaagtcctggaaaccgcctctcgtgtaaaaaactgggcaaggctgagtacaatacaccaa-aa |
25944566 |
T |
 |
| Q |
169 |
tggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
||||||||||||||||| ||||| || |||| ||||||||||| ||||| || |||||||||| |
|
|
| T |
25944567 |
tggtgggaccccttccctgaccctgcgtatgtgggagctttagcgcaccaggctgcccttttt |
25944629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 81 - 230
Target Start/End: Complemental strand, 54032705 - 54032570
Alignment:
| Q |
81 |
tcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggacccc |
180 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
54032705 |
tcatgtgactggaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc--gaatggtgg------ |
54032614 |
T |
 |
| Q |
181 |
ttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
54032613 |
------gaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
54032570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 122 - 231
Target Start/End: Original strand, 15797274 - 15797379
Alignment:
| Q |
122 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
221 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||| |||||||||||||||||| ||||| ||||||| ||||||| ||||||||||||| |
|
|
| T |
15797274 |
cctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgtgggagctctagtgcaccgggt |
15797369 |
T |
 |
| Q |
222 |
tgcccttttt |
231 |
Q |
| |
|
|||||||||| |
|
|
| T |
15797370 |
tgcccttttt |
15797379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 64 - 230
Target Start/End: Complemental strand, 25517336 - 25517169
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgag--ggaaacaacctcttgtgtaaaaaa-cagggtaaggctgcatacaatac |
160 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| || | | | || ||||||| |||||||||||||||| || | || |||||| |||||||| |
|
|
| T |
25517336 |
aactggtaaagttgttgtcatgtgactggaaggtcacaggatgatgggacctggaaacatcctcttgtgtaaaaaaacaagatatggctgcgtacaatac |
25517237 |
T |
 |
| Q |
161 |
accaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
|| || |||||||||||||||||| || || || ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
25517236 |
acaaa--atggtgggaccccttcccggatcctgcgtatgctggagctttagtgcaccgggttgccctttt |
25517169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 134 - 232
Target Start/End: Complemental strand, 34771457 - 34771361
Alignment:
| Q |
134 |
aaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttta |
232 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||||||||||| ||||| ||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
34771457 |
aaaacagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggctgcccttttta |
34771361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 64 - 228
Target Start/End: Complemental strand, 7697048 - 7696893
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||||||||||||| ||||||| ||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
7697048 |
aactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctggaaacagtctcttgtgt--aaaacagggtaaggctgcgtacaatacacc |
7696951 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctt |
228 |
Q |
| |
|
| ||||| ||||||||| ||| | ||||||| ||||||| |||||||||||||| ||||| |
|
|
| T |
7696950 |
a--aatgg-----ccccttcccggacactgcatatgtgggagctctagtgcaccgggtttccctt |
7696893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 72 - 209
Target Start/End: Complemental strand, 30928302 - 30928167
Alignment:
| Q |
72 |
aagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatgg |
171 |
Q |
| |
|
||||| ||||||||| |||| |||||||||||||||||| ||||||| |||||||||||||||||| ||||||| || || ||||||||||| ||| |
|
|
| T |
30928302 |
aagttcttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacaaggtaaggttgtgtaaaatacaccaat--tgg |
30928205 |
T |
 |
| Q |
172 |
tgggaccccttcccagaccccgcatatgcgggagcttt |
209 |
Q |
| |
|
||||||||||||| ||||| ||||||| ||||||||| |
|
|
| T |
30928204 |
cgggaccccttcccggaccctgcatatgtgggagcttt |
30928167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 81 - 213
Target Start/End: Original strand, 33926094 - 33926224
Alignment:
| Q |
81 |
tcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggacccc |
180 |
Q |
| |
|
|||||| |||| ||||||| |||||||||| ||||| | ||||||||||||||| ||||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
33926094 |
tcatgtgactgaaaggtcatgggttcaagtcctggaaatagcctcttgtgtaaaaa-cagggtaaggctgtgtacaatacacca-taatggtgggacccc |
33926191 |
T |
 |
| Q |
181 |
ttcccagaccccgcatatgcgggagctttagtg |
213 |
Q |
| |
|
|||| ||||| ||||||||| ||||||||||| |
|
|
| T |
33926192 |
ttcctggaccctgcatatgcgagagctttagtg |
33926224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 68 - 166
Target Start/End: Complemental strand, 45620988 - 45620889
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaa-aaaacagggtaaggctgcatacaatacaccaat |
166 |
Q |
| |
|
|||||||||||||||| || |||| |||||||||||||||||| ||||||| |||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
45620988 |
ggtaaagttgttgtcacgtgactgaaaggtcacgggttcaagttctggaaacagcctcttgtgtaaaaaaacagggtaaggctgcgtacaatacaccaat |
45620889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 64 - 151
Target Start/End: Complemental strand, 10870114 - 10870028
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgc |
151 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||||| ||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
10870114 |
aactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgta-aaaacagggtaaggctgc |
10870028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 68 - 225
Target Start/End: Original strand, 19731000 - 19731155
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
167 |
Q |
| |
|
|||||| ||||||||| || | || |||||||||| | ||||| ||||| | |||||||||||||||||| ||||||| ||| ||||||||||| || |
|
|
| T |
19731000 |
ggtaaatttgttgtcacgtgattgaaaggtcacggatgcaagtcctggaaatagcctcttgtgtaaaaaacaaggtaaggttgcgtacaatacacc--ta |
19731097 |
T |
 |
| Q |
168 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcc |
225 |
Q |
| |
|
||||||||||| ||||||||| | | ||||| ||||||||||||||||||| |||| |
|
|
| T |
19731098 |
ttggtgggaccctttcccagactctgtgtatgcaggagctttagtgcaccgggctgcc |
19731155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 167 - 231
Target Start/End: Complemental strand, 24851363 - 24851299
Alignment:
| Q |
167 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
||||||||||||||||||| || || ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24851363 |
aatggtgggaccccttcccggatcctgcatatgcgggagctttagtgcaccgggttgcccttttt |
24851299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 169 - 230
Target Start/End: Original strand, 30452892 - 30452953
Alignment:
| Q |
169 |
tggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30452892 |
tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
30452953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 115 - 219
Target Start/End: Complemental strand, 829555 - 829452
Alignment:
| Q |
115 |
gaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgc |
214 |
Q |
| |
|
||||||||||||||| |||| |||| |||| | ||| ||||||||||||| ||||||||||||||||||| |||| || ||||| ||||||||||||| |
|
|
| T |
829555 |
gaaacaacctcttgtctaaagaacatagtaaagttgcgtacaatacaccaa-aatggtgggaccccttcccgaaccctgcgtatgcaggagctttagtgc |
829457 |
T |
 |
| Q |
215 |
accgg |
219 |
Q |
| |
|
||||| |
|
|
| T |
829456 |
accgg |
829452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 122 - 229
Target Start/End: Original strand, 9276316 - 9276419
Alignment:
| Q |
122 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| |||||| |||||| ||||| ||||| || ||||||||| ||||| ||| | |||| |
|
|
| T |
9276316 |
cctcttgtgtaaaaaacagggtaaggctgcgtacaatacacca--aatggt-ggaccctttcccggaccctgcgtatgcgggaacttta-tgcgcagggt |
9276411 |
T |
 |
| Q |
222 |
tgcccttt |
229 |
Q |
| |
|
|||||||| |
|
|
| T |
9276412 |
tgcccttt |
9276419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 77 - 231
Target Start/End: Original strand, 12525414 - 12525566
Alignment:
| Q |
77 |
gttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtggga |
176 |
Q |
| |
|
|||||||| | |||| |||||||| ||||| ||| ||||||| ||||||||||||||| |||||||||||||| | |||||||| |||||||||| |
|
|
| T |
12525414 |
gttgtcatatgactgaaaggtcacaggttcgagtcctggaaacagcctcttgtgtaaaaatcagggtaaggctgc--gaagtacaccaaaaatggtggga |
12525511 |
T |
 |
| Q |
177 |
ccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
| |||||| |||||| | ||| ||||||||| | |||||| |||||| |||||| |
|
|
| T |
12525512 |
caccttcctagaccctgtgtatacgggagcttcactgcaccaggttgctcttttt |
12525566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 116 - 225
Target Start/End: Original strand, 55401222 - 55401330
Alignment:
| Q |
116 |
aaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgca |
215 |
Q |
| |
|
||||| |||||||||||||||||||| |||| |||| || |||||||||| ||||||||||||||||| | |||| | |||||||||||||| |||| |
|
|
| T |
55401222 |
aaacagcctcttgtgtaaaaaacaggttaagactgcgtataatacaccaa-aatggtgggaccccttctcggaccttccgtatgcgggagcttttttgca |
55401320 |
T |
 |
| Q |
216 |
ccgggttgcc |
225 |
Q |
| |
|
||||| |||| |
|
|
| T |
55401321 |
ccgggctgcc |
55401330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 116 - 191
Target Start/End: Original strand, 47624088 - 47624160
Alignment:
| Q |
116 |
aaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccc |
191 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||| |||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
47624088 |
aaacagcctcttgtgtaaaa-acagggtaaggctgcgtacaatacacca--aatggtgggaccccttcccggaccc |
47624160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 122 - 232
Target Start/End: Complemental strand, 44403661 - 44403552
Alignment:
| Q |
122 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
221 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| | ||||| ||| ||||||||||||||||||| ||||| | ||||| | ||||||||||||||||| |
|
|
| T |
44403661 |
cctcttgtgtaaaagacaaggtaaggctgcggagaataccacaa-aatggtgggaccccttcccggaccctacgtatgctgaagctttagtgcaccgggc |
44403563 |
T |
 |
| Q |
222 |
tgcccttttta |
232 |
Q |
| |
|
|||| |||||| |
|
|
| T |
44403562 |
tgcctttttta |
44403552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 66 - 228
Target Start/End: Original strand, 33235526 - 33235687
Alignment:
| Q |
66 |
ctggtaaagttgttgtcatgtaac-tggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaa-cagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||| || || |||||||| |||||| | | ||| | |||||||||||||||| ||||||||| ||| |||||||||| |
|
|
| T |
33235526 |
ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaagagcctcttgtgtaaaaaaacagggtaagactgtgtacaatacact |
33235625 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctt |
228 |
Q |
| |
|
|| |||||||||||||| | |||||| | ||||||| |||||||||||||| |||||||||| |
|
|
| T |
33235626 |
aa--atggtgggacccct-cgcagaccttacgtatgcggaagctttagtgcaccaggttgccctt |
33235687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 115 - 231
Target Start/End: Complemental strand, 50625065 - 50624951
Alignment:
| Q |
115 |
gaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgc |
214 |
Q |
| |
|
|||||| ||||||||||| |||| ||||||||| || |||||||||||| | ||||||||| |||||| | ||| || || | |||||||||||||| |
|
|
| T |
50625065 |
gaaacagcctcttgtgtataaaaaagggtaaggtagcgtacaatacaccatt--tggtgggacgccttcctgggccctgcgtaagtgggagctttagtgc |
50624968 |
T |
 |
| Q |
215 |
accgggttgcccttttt |
231 |
Q |
| |
|
|||||| |||||||||| |
|
|
| T |
50624967 |
accgggctgcccttttt |
50624951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 174 - 230
Target Start/End: Complemental strand, 10484671 - 10484615
Alignment:
| Q |
174 |
ggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
||||||||||| ||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
10484671 |
ggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
10484615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 167 - 231
Target Start/End: Original strand, 24577930 - 24577994
Alignment:
| Q |
167 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|||||||||| || ||||||||||| |||||| |||||||| ||||||||||| ||||||||||| |
|
|
| T |
24577930 |
aatggtgggatcctttcccagaccctgcatatacgggagctctagtgcaccggattgcccttttt |
24577994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 167 - 231
Target Start/End: Original strand, 24578020 - 24578084
Alignment:
| Q |
167 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
||||||||||| | ||||||||||| ||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
24578020 |
aatggtgggactctttcccagaccctacatatgcgggaactctagtgcaccgggttgcccttttt |
24578084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 122 - 232
Target Start/End: Original strand, 26292384 - 26292490
Alignment:
| Q |
122 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
221 |
Q |
| |
|
|||||||||||||| ||||||||| | || ||| ||||||||| ||| ||||| |||||||| |||| |||||||||||| || ||||||||||||| |
|
|
| T |
26292384 |
cctcttgtgtaaaa--cagggtaagaccgcgtacgatacaccaa--atgatgggatcccttcccgaaccctgcatatgcgggaactctagtgcaccgggt |
26292479 |
T |
 |
| Q |
222 |
tgcccttttta |
232 |
Q |
| |
|
|| |||||||| |
|
|
| T |
26292480 |
tgtccttttta |
26292490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 114 - 228
Target Start/End: Complemental strand, 31904970 - 31904857
Alignment:
| Q |
114 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtggga-ccccttcccagaccccgcatatgcgggagctttagt |
212 |
Q |
| |
|
||||||| ||| || |||||||||||||||| | |||| |||||||||||| |||||||||| |||||||||||| | | | ||||||||||||||| |
|
|
| T |
31904970 |
ggaaacagcctattatgtaaaaaacagggtatgactgcgtacaatacacca--aatggtgggacccccttcccagatcttacgtgtgcgggagctttagt |
31904873 |
T |
 |
| Q |
213 |
gcaccgggttgccctt |
228 |
Q |
| |
|
||||| || ||||||| |
|
|
| T |
31904872 |
gcaccaggctgccctt |
31904857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 167 - 231
Target Start/End: Original strand, 35417999 - 35418063
Alignment:
| Q |
167 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||| ||||||||||||| |||| ||||| |||| |
|
|
| T |
35417999 |
aatggtgggaccccttcccggaccccgcaaatgcgagagctttagtgcatcgggctgcccatttt |
35418063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 68 - 144
Target Start/End: Original strand, 53062036 - 53062112
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggta |
144 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||| |||||||| ||||||| |||| ||||| |||||||||||| |
|
|
| T |
53062036 |
ggtaaagttgttgtcatgtgactgaaaggtcacgtgttcaagtcctggaaacagcctcctgtgtcaaaaacagggta |
53062112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 76 - 209
Target Start/End: Complemental strand, 8411016 - 8410887
Alignment:
| Q |
76 |
tgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtggg |
175 |
Q |
| |
|
|||||||||| |||| |||||||| |||||| || |||||| |||| |||||||||||||||||||||||| ||||||||||| | ||||||| |
|
|
| T |
8411016 |
tgttgtcatgggactgaaaggtcaccggttcaggtcctggaaactgcctc--gtgtaaaaaacagggtaaggctgctcacaatacacca--actggtggg |
8410921 |
T |
 |
| Q |
176 |
accccttcccagaccccgcatatgcgggagcttt |
209 |
Q |
| |
|
||| |||| ||||||| ||||| |||| |||||| |
|
|
| T |
8410920 |
acctcttctcagaccctgcataggcggaagcttt |
8410887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 68 - 225
Target Start/End: Original strand, 19751576 - 19751731
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
167 |
Q |
| |
|
|||||| || |||||| || | || |||||||||| | ||||| ||||| | ||||||||||||||| || ||||||| ||| ||||||||||| || |
|
|
| T |
19751576 |
ggtaaattttttgtcacgtgattgaaaggtcacggatgcaagtcctggaaatagcctcttgtgtaaaaatcaaggtaaggttgcgtacaatacacc--ta |
19751673 |
T |
 |
| Q |
168 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcc |
225 |
Q |
| |
|
||||||||||| ||||||||| | ||||| |||||||||||||||||| |||| |
|
|
| T |
19751674 |
ttggtgggaccctttcccagactttgtgtatgcatgagctttagtgcaccgggctgcc |
19751731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 67 - 165
Target Start/End: Original strand, 26782363 - 26782461
Alignment:
| Q |
67 |
tggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaa |
165 |
Q |
| |
|
|||||||||| |||||||| | || |||||||||| ||||||| ||||||| ||||||||||||||| ||||||| |||| ||| |||||||||| |
|
|
| T |
26782363 |
tggtaaagttattgtcatgcgattgaaaggtcacggattcaagtccttgaaacaatctcttgtgtaaaaaatagggtaatgctgtataaaatacaccaa |
26782461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 181 - 231
Target Start/End: Original strand, 47624208 - 47624258
Alignment:
| Q |
181 |
ttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
||||| ||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
47624208 |
ttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttttt |
47624258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 30 - 67
Target Start/End: Complemental strand, 10795913 - 10795876
Alignment:
| Q |
30 |
ctgacaatctttgctttaacttgtactctgatgtaact |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10795913 |
ctgacaatctttgctttaacttgtactctgatgtaact |
10795876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 64 - 162
Target Start/End: Original strand, 21875014 - 21875106
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgt-aaaaaacagggtaaggctgcatacaatacac |
162 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||| | |||||||||||||||||| |||||| ||||||||||||| |||||||||| |
|
|
| T |
21875014 |
aactggtaaagttgttgtcatgtgactg-------acgggttcaaattctggaaacaacctcttgtgttaaaaaagagggtaaggctgcgtacaatacac |
21875106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 72 - 161
Target Start/End: Original strand, 39211992 - 39212081
Alignment:
| Q |
72 |
aagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaataca |
161 |
Q |
| |
|
||||||| || |||| |||| || ||||||||||||||| ||||| ||||||||||||||| |||| |||||| |||| ||||||||| |
|
|
| T |
39211992 |
aagttgtcgttatgtgactgaaatgtcacgggttcaagtcctggaaataacctcttgtgtaaataacaaggtaagactgcgtacaataca |
39212081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 114 - 215
Target Start/End: Complemental strand, 43114983 - 43114882
Alignment:
| Q |
114 |
ggaaacaacctcttgtgtaaaaaa-cagggtaagg-ctgcatacaatacaccaataatggtgggaccccttcccagacccc-gcatatgcgggagcttta |
210 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||| || | ||||||||||||| |||||||||||| |||| |||||| || ||||||||||||||| |
|
|
| T |
43114983 |
ggaaacagcctcttgtgtaaaaaaacagggtaagggctacctacaatacaccaa--atggtgggaccc-ttcctggacccctgcgtatgcgggagcttta |
43114887 |
T |
 |
| Q |
211 |
gtgca |
215 |
Q |
| |
|
||||| |
|
|
| T |
43114886 |
gtgca |
43114882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 78 - 165
Target Start/End: Complemental strand, 52428627 - 52428539
Alignment:
| Q |
78 |
ttgtcatgtaactggaaggtcacgggttcaagtgag-ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaa |
165 |
Q |
| |
|
|||||| ||| ||| ||||||||||||| |||| |||| || |||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
52428627 |
ttgtcacgtagctgaaaggtcacgggtttaagtctctggaagcagcctcttgtgtaaaatacagggtaaggctgcgtacaatacaccaa |
52428539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 196 - 231
Target Start/End: Original strand, 40390365 - 40390400
Alignment:
| Q |
196 |
tatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
40390365 |
tatgcgggagctttagtgcaccgggttgcccttttt |
40390400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 167 - 230
Target Start/End: Original strand, 40968613 - 40968676
Alignment:
| Q |
167 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
||||||| |||||||||| |||||| |||||||||||||||||||||| || | ||||||||| |
|
|
| T |
40968613 |
aatggtgagaccccttcctagaccctacatatgcgggagctttagtgcatcgagctgccctttt |
40968676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 68 - 142
Target Start/End: Original strand, 35417914 - 35417988
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacaggg |
142 |
Q |
| |
|
|||||||||||| |||||| |||| |||||||| |||||| | ||||||| ||||||||||||||||||||| |
|
|
| T |
35417914 |
ggtaaagttgttatcatgtgactgagaggtcacgagttcaaatcctggaaacagcctcttgtgtaaaaaacaggg |
35417988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 187 - 231
Target Start/End: Complemental strand, 6242327 - 6242283
Alignment:
| Q |
187 |
gaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
||||| |||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
6242327 |
gaccctgcatatgcaggagctctagtgcaccgggttgcccttttt |
6242283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 114 - 165
Target Start/End: Original strand, 31831243 - 31831292
Alignment:
| Q |
114 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaa |
165 |
Q |
| |
|
||||||| |||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
31831243 |
ggaaacagcctcttgtgtaaaata--gggtaaggctgcatacaatacaccaa |
31831292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 187 - 231
Target Start/End: Complemental strand, 43956514 - 43956470
Alignment:
| Q |
187 |
gaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
||||| || ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43956514 |
gacccagcgtatgcgggagctttagtgcaccgggctgcccttttt |
43956470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 187 - 229
Target Start/End: Original strand, 31831301 - 31831343
Alignment:
| Q |
187 |
gaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
||||| ||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
31831301 |
gaccctgcatatgcgggtgctctagtgcaccgggttgcccttt |
31831343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 170 - 231
Target Start/End: Complemental strand, 10696272 - 10696211
Alignment:
| Q |
170 |
ggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|||||||||||||||||||||| || | | ||||||| ||||||||| || |||||||||| |
|
|
| T |
10696272 |
ggtgggaccccttcccagaccctgcgtctacgggagcattagtgcactaggctgcccttttt |
10696211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 196 - 229
Target Start/End: Complemental strand, 14266405 - 14266372
Alignment:
| Q |
196 |
tatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
14266405 |
tatgcgggagctttagtgcactgggttgcccttt |
14266372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 107 - 228
Target Start/End: Original strand, 16130312 - 16130432
Alignment:
| Q |
107 |
aagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagc |
206 |
Q |
| |
|
|||||| | ||||| | |||| |||||||| |||| ||||||||| |||||||||||| ||||||||||||| ||| ||||| || || | ||||| |
|
|
| T |
16130312 |
aagtgatgaaaacatcgtcttctgtaaaaagcaggataaggctgcgaacaatacaccaa-aatggtgggaccctgtcctagaccttgcgtacacaggagc |
16130410 |
T |
 |
| Q |
207 |
tttagtgcaccgggttgccctt |
228 |
Q |
| |
|
||||||||| ||| ||||||| |
|
|
| T |
16130411 |
tttagtgcattgggctgccctt |
16130432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 196 - 229
Target Start/End: Original strand, 23871490 - 23871523
Alignment:
| Q |
196 |
tatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
23871490 |
tatgcgggaactttagtgcaccgggttgcccttt |
23871523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 76 - 165
Target Start/End: Original strand, 29106555 - 29106644
Alignment:
| Q |
76 |
tgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaa |
165 |
Q |
| |
|
||||||||||| || ||| |||||||| ||||| | |||||||||||||||||||||| ||| ||||| | | ||||||||||||| |
|
|
| T |
29106555 |
tgttgtcatgtggctcaaagatcacgggtacaagtcttgaaaacaacctcttgtgtaaaaaataggataaggttacgtacaatacaccaa |
29106644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 69 - 177
Target Start/End: Original strand, 32418221 - 32418329
Alignment:
| Q |
69 |
gtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataa |
168 |
Q |
| |
|
||||||||||||||| || |||| || |||| ||| |||| | ||||||||||||| |||||| |||| |||| |||||||||||| || || || |
|
|
| T |
32418221 |
gtaaagttgttgtcaagtgactgaaatgtcattagtttaagtcatagaaacaacctcttacataaaaatcaggataagactgcatacaataaacaaaaaa |
32418320 |
T |
 |
| Q |
169 |
tggtgggac |
177 |
Q |
| |
|
||||||||| |
|
|
| T |
32418321 |
tggtgggac |
32418329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 167 - 215
Target Start/End: Complemental strand, 46170029 - 46169981
Alignment:
| Q |
167 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgca |
215 |
Q |
| |
|
|||||| |||||||||||| ||||| ||||||| |||||||| |||||| |
|
|
| T |
46170029 |
aatggtaggaccccttcccggaccctgcatatgtgggagcttcagtgca |
46169981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 135; Significance: 3e-70; HSPs: 88)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 135; E-Value: 3e-70
Query Start/End: Original strand, 64 - 230
Target Start/End: Complemental strand, 20004255 - 20004089
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| ||||| |||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
20004255 |
aactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctctcgtgtaaaaaacaaggtaaggctgcgtacaatacacc |
20004156 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20004155 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
20004089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 64 - 230
Target Start/End: Complemental strand, 30395891 - 30395725
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30395891 |
aactggtaaagttgttgtcatgtgactttaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacacc |
30395792 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30395791 |
aataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgagttgccctttt |
30395725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 64 - 231
Target Start/End: Original strand, 18944638 - 18944806
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||| |||||||| ||||||| |||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
18944638 |
aactggtaaagttgttgtcatgtgactgaaaggtcacaggttcaaggcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacacc |
18944737 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagc-tttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|| ||||||||||||||||||| ||||| || ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
18944738 |
aacaatggtgggaccccttcccggaccctgcgtatgcgggagcttttagtgcaccgggttgcccttttt |
18944806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 64 - 231
Target Start/End: Original strand, 46991799 - 46991964
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
46991799 |
aactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaaggctgtgtacaatacacc |
46991898 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
||||||||||||||||||| ||||| || |||| |||||||||||||||||||||||||| |||| |
|
|
| T |
46991899 |
--gaatggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcaccgggttgcccatttt |
46991964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 64 - 231
Target Start/End: Complemental strand, 46248116 - 46247951
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| |||| || ||||||||||||||| ||||||| ||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
46248116 |
aactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaagtcttggaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacc |
46248017 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
| ||||||||||||||||||| ||||| || |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
46248016 |
a--aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgtaccgggttgcccttttt |
46247951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 64 - 224
Target Start/End: Complemental strand, 23768483 - 23768325
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||| ||||||||| | ||||||| |||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
23768483 |
aactggtaaagttgttgtcatgtgactgtaaggtcacaggttcaagtcatggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacacc |
23768384 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgc |
224 |
Q |
| |
|
| ||||||||||| ||||||||||||| || |||||||||||||||||||| ||| |||| |
|
|
| T |
23768383 |
a--aatggtgggacaccttcccagaccctgcgtatgcgggagctttagtgcagcggattgc |
23768325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 64 - 230
Target Start/End: Complemental strand, 34725259 - 34725097
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||||| ||||||| |||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
34725259 |
aactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacact |
34725162 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
|| |||||||||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34725161 |
aa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
34725097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 64 - 230
Target Start/End: Original strand, 10668215 - 10668386
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaa-----ctggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaat |
158 |
Q |
| |
|
||||||||||||||||||||||| | ||| |||||||||||||||||| ||||||| |||||||||||||||||| ||||||| ||| |||||| |
|
|
| T |
10668215 |
aactggtaaagttgttgtcatgtgatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacaaggtaaggttgcgtacaat |
10668314 |
T |
 |
| Q |
159 |
acaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
||||||||||||||||||||||||||| | ||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
10668315 |
acaccaataatggtgggaccccttcccggtccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
10668386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 88 - 230
Target Start/End: Original strand, 35005142 - 35005284
Alignment:
| Q |
88 |
actggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccag |
187 |
Q |
| |
|
|||| |||||||||||||||||| | ||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| | |
|
|
| T |
35005142 |
actgaaaggtcacgggttcaagtcttgaaaacagcctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaaaaatggtgggaccccttcccgg |
35005241 |
T |
 |
| Q |
188 |
accccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
|||| || |||||||| |||||||||||||||||||||||||| |
|
|
| T |
35005242 |
accctgcgtatgcgggcgctttagtgcaccgggttgccctttt |
35005284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 62 - 231
Target Start/End: Original strand, 27201640 - 27201809
Alignment:
| Q |
62 |
gtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaataca |
161 |
Q |
| |
|
|||| |||||||||||||||||||| |||| ||||||| |||||||||| ||||||| |||||||||| | ||||||||||||||||| ||||||||| |
|
|
| T |
27201640 |
gtaaatggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacagcctcttgtgtcagaaacagggtaaggctgcgtacaataca |
27201739 |
T |
 |
| Q |
162 |
ccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|||| ||||||||||||||||||| |||| || |||||||||||||||||||| |||||||||||||| |
|
|
| T |
27201740 |
ccaaaaatggtgggaccccttcccggaccttgcgtatgcgggagctttagtgcattgggttgcccttttt |
27201809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 64 - 230
Target Start/End: Complemental strand, 32632719 - 32632556
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||| | |||| |||||||||||||||||| ||||||| ||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
32632719 |
aactggtaaagttgttgtcatatgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgta-aaaacagggtaaggctgcgtacaatacacc |
32632621 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
| |||||||||||||||||||| |||| |||||||||||||||| |||||||| |||| ||||||| |
|
|
| T |
32632620 |
a--aatggtgggaccccttcccaaaccctgcatatgcgggagcttgagtgcaccaggtttccctttt |
32632556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 65 - 231
Target Start/End: Original strand, 6925096 - 6925260
Alignment:
| Q |
65 |
actggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacca |
164 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| ||||| | |||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
6925096 |
actggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaatagcctcttgtgtaaaaaatagggtaaggctgcggacaatacacc- |
6925194 |
T |
 |
| Q |
165 |
ataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
||||||||||||||||||| | ||| || ||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
6925195 |
-gaatggtgggaccccttcccggtccctgcgtatgcgggagctttagtgcaccgagttgcctttttt |
6925260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 68 - 230
Target Start/End: Original strand, 14617037 - 14617197
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
167 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||| |||||||| ||||||| ||||||||||||| |||| ||||||| ||| |||||||||||| | |
|
|
| T |
14617037 |
ggtaaagttgttgtcatgtgactgaaaggtcacgagttcaagtcctggaaacagcctcttgtgtaaataacaaggtaaggttgcgtacaatacacca--a |
14617134 |
T |
 |
| Q |
168 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
||||||||| |||||||| ||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
14617135 |
atggtgggatcccttcccggaccctgcatatgcgggagctttagtgcaccgggttaccctttt |
14617197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 91; E-Value: 6e-44
Query Start/End: Original strand, 64 - 232
Target Start/End: Complemental strand, 18742124 - 18741954
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagt-gagggaaacaacctcttgtgt-aaaaaacagggtaaggctgcatacaataca |
161 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||| |||||||| | |||||||| || |||| | |||||||||||||||||||| ||||||||| |
|
|
| T |
18742124 |
aactggtaaagttgttgtcatgtgactgaaaggtcaagggttcaaatcttgggaaacagtcttttgtataaaaaaacagggtaaggctgcgtacaataca |
18742025 |
T |
 |
| Q |
162 |
ccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttta |
232 |
Q |
| |
|
|||| ||||||||||||||||||||||||| || |||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
18742024 |
ccaaaaatggtgggaccccttcccagaccctgcgtatgcgagagctttagtgcaccgggtttcccttttta |
18741954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 86; E-Value: 6e-41
Query Start/End: Original strand, 64 - 231
Target Start/End: Complemental strand, 38478443 - 38478280
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
|||| ||||| |||||||||||| |||| |||||||||||||||||| |||||| |||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
38478443 |
aactagtaaacttgttgtcatgtgactgaaaggtcacgggttcaagtcctagaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacacc |
38478346 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|| ||||||| |||||||| | ||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38478345 |
aa--atggtggaaccccttctcggaccctgcatatgcgggagctctagtgcaccgggttgcccttttt |
38478280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 86; E-Value: 6e-41
Query Start/End: Original strand, 64 - 231
Target Start/End: Complemental strand, 45812698 - 45812535
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||| ||||||||||||||||| |||| |||||||| ||||||||| | ||||| ||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
45812698 |
aactgataaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctgaaaacagtctcttgtgtaaaaga--gggtaaggctgcatacaatacacc |
45812601 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|| ||||||||||||||||||| |||| ||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
45812600 |
aa--atggtgggaccccttcccaaaccctgcatatgcgggagctctagtgcaccgggttgcctttttt |
45812535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 86; E-Value: 6e-41
Query Start/End: Original strand, 64 - 231
Target Start/End: Original strand, 47214506 - 47214669
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||||| ||||||| ||||||| ||||| |||||||||| ||| ||||||||||| |
|
|
| T |
47214506 |
aactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagtctcttgtttaaaa--cagggtaaggttgcgtacaatacacc |
47214603 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|| |||||||||||||||||||||||| ||||||||||||||| ||||||||| | || |||||||| |
|
|
| T |
47214604 |
aa--atggtgggaccccttcccagaccctgcatatgcgggagctctagtgcaccagattacccttttt |
47214669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 64 - 227
Target Start/End: Complemental strand, 19932915 - 19932755
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||| |||||||||| ||| ||||||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
19932915 |
aactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtt--ggatacaacct-ttgtgtaaaaaacagggtaaggctgcgtacaatacacc |
19932819 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccct |
227 |
Q |
| |
|
|| ||||||||||||||||||| ||||| || ||||| || | |||||||||| ||||||||| |
|
|
| T |
19932818 |
aaaaatggtgggaccccttcccggaccctgcgtatgcaagatcattagtgcaccaggttgccct |
19932755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 84; E-Value: 9e-40
Query Start/End: Original strand, 64 - 230
Target Start/End: Complemental strand, 41319969 - 41319805
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||| |||| |||| ||||||| ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
41319969 |
aactggtaaagttgttgtcatgtgactgaaaggtcacaggtttaagtcctggaaacagtctcttgtgtaaaaaacagggtaaggctgcgtacaatacacc |
41319870 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
| |||| |||||||||||||| |||| |||||||||||| || ||||||| ||||||||||||| |
|
|
| T |
41319869 |
a--aatgatgggaccccttcccgaacccttcatatgcgggagtttcagtgcactgggttgccctttt |
41319805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 71 - 235
Target Start/End: Original strand, 9939463 - 9939628
Alignment:
| Q |
71 |
aaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatg |
170 |
Q |
| |
|
|||||||||||||||| |||| ||||||||| |||||||| |||||||||||||||| ||| ||||| ||||||| ||| | ||||||||||| |||| |
|
|
| T |
9939463 |
aaagttgttgtcatgtgactgaaaggtcacgagttcaagtcctggaaacaacctcttgtttaagaaacatggtaaggttgcgtgcaatacaccaaaaatg |
9939562 |
T |
 |
| Q |
171 |
gtggga-ccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttttagtg |
235 |
Q |
| |
|
|||||| ||||||| | ||||| || ||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
9939563 |
gtgggacccccttctcggaccctgcgtatgcgggagctttagtgcaccgggttacccttttaagtg |
9939628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 64 - 230
Target Start/End: Complemental strand, 12126998 - 12126836
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
|||| |||||||||||||||||||| || ||||||||||||| |||| ||||||| | |||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
12126998 |
aactcgtaaagttgttgtcatgtaattgaaaggtcacgggtttaagttctggaaacagcttcttgtgtaaaa--cagggtaaggctgcgtacaatacacc |
12126901 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
|| || ||||||||||||||| ||||| ||||||||||||||| |||||||| | ||||||||||| |
|
|
| T |
12126900 |
aa--attgtgggaccccttcccggaccctgcatatgcgggagctgtagtgcactgcgttgccctttt |
12126836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 64 - 231
Target Start/End: Original strand, 45402090 - 45402256
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggt--aagg-ctgcatacaatac |
160 |
Q |
| |
|
||||||||||||||||||||||| | |||||||| |||||||||||| ||||||| ||||||||||||||| |||||| ||| |||| |||||||| |
|
|
| T |
45402090 |
aactggtaaagttgttgtcatgtga-tggaaggtaacgggttcaagtcctggaaacagcctcttgtgtaaaaa-cagggttcaagttctgcgtacaatac |
45402187 |
T |
 |
| Q |
161 |
accaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
||||| |||||||||||||||||||||||| || ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45402188 |
accaa--atggtgggaccccttcccagaccctgcgtatgcgggagctttagtgcaccgggttgcccgtttt |
45402256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 64 - 230
Target Start/End: Original strand, 27474276 - 27474439
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||| ||||||||| ||||||| |||||||||||||| ||||| || ||||| |||||||||| |
|
|
| T |
27474276 |
aactggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcttggaaacagtctcttgtgtaaaaa-cagggcaaagctgcgtacaatacact |
27474374 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
| |||||||||||||||||| ||||| || |||||||||||||||||||||||| |||||||||| |
|
|
| T |
27474375 |
ga--atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggattgccctttt |
27474439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 79; E-Value: 9e-37
Query Start/End: Original strand, 68 - 209
Target Start/End: Complemental strand, 18724704 - 18724565
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
167 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||||||| ||||||| ||||||||||||||||||||||||||||| |||||||||||| | |
|
|
| T |
18724704 |
ggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgtgtacaatacacca--a |
18724607 |
T |
 |
| Q |
168 |
atggtgggaccccttcccagaccccgcatatgcgggagcttt |
209 |
Q |
| |
|
|| |||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
18724606 |
atcttgggaccccttcccggaccctacatatgcgggagcttt |
18724565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 79; E-Value: 9e-37
Query Start/End: Original strand, 62 - 230
Target Start/End: Original strand, 19414432 - 19414596
Alignment:
| Q |
62 |
gtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaataca |
161 |
Q |
| |
|
|||| |||||||||||||||||| | |||| |||||||||||||||||| |||| | |||||| ||| |||||||| ||||||||| ||||||||| |
|
|
| T |
19414432 |
gtaattggtaaagttgttgtcatatgactgaaaggtcacgggttcaagtcctagaaagagcctcttatgt--aaaacaggttaaggctgcgtacaataca |
19414529 |
T |
 |
| Q |
162 |
ccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
||| ||||||||||||||||||| |||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
19414530 |
cca--aatggtgggaccccttcccgtaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
19414596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 79; E-Value: 9e-37
Query Start/End: Original strand, 68 - 229
Target Start/End: Complemental strand, 35117927 - 35117765
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
167 |
Q |
| |
|
|||||||||||||||| || |||| |||||||||||||||||| ||||| | |||||||||||||| |||||||||||||| ||||||||||||| | |
|
|
| T |
35117927 |
ggtaaagttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaatagcctcttgtgtaaaatacagggtaaggctgtgtacaatacaccaaaa |
35117828 |
T |
 |
| Q |
168 |
atggtgggaccccttcccagaccccgcat-atgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
||| |||||||||||||| ||||| || | |||| ||||||||||||||||||| | |||||| |
|
|
| T |
35117827 |
atgatgggaccccttcccggaccctgcgtaatgcaggagctttagtgcaccgggcttcccttt |
35117765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 83 - 232
Target Start/End: Complemental strand, 35253329 - 35253184
Alignment:
| Q |
83 |
atgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggacccctt |
182 |
Q |
| |
|
|||| |||| ||| |||||||||||||| |||||| |||||||||||||| |||||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
35253329 |
atgtgactgaaagatcacgggttcaagtcctcgaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggacccctt |
35253234 |
T |
 |
| Q |
183 |
cccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttta |
232 |
Q |
| |
|
||| ||||| ||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
35253233 |
cccggaccctgcatatgcgggagctctagtgcaccggattgcccttttta |
35253184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 130 - 229
Target Start/End: Original strand, 4349699 - 4349796
Alignment:
| Q |
130 |
gtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |||||||||||||||||| ||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
4349699 |
gtaaaaaacagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
4349796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 69 - 207
Target Start/End: Complemental strand, 25468421 - 25468285
Alignment:
| Q |
69 |
gtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataa |
168 |
Q |
| |
|
|||||||||||||||||| | || ||||||| |||||||||| ||||||||||||||||||||||| |||||||||| ||| |||||||||||| || |
|
|
| T |
25468421 |
gtaaagttgttgtcatgtgattgaaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaaatcagggtaaggttgcgtacaatacacca--aa |
25468324 |
T |
 |
| Q |
169 |
tggtgggaccccttcccagaccccgcatatgcgggagct |
207 |
Q |
| |
|
|||| ||||| |||||||||||| || |||||||||||| |
|
|
| T |
25468323 |
tggttggacctcttcccagaccctgcgtatgcgggagct |
25468285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 69 - 231
Target Start/End: Original strand, 19701570 - 19701731
Alignment:
| Q |
69 |
gtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataa |
168 |
Q |
| |
|
|||||||||||||| ||| |||| || |||||||||| |||| | | ||||| ||||||||||||||||| ||||||| || ||||||||||||| || |
|
|
| T |
19701570 |
gtaaagttgttgtcgtgtgactgaaatgtcacgggtttaagtcatgaaaacagcctcttgtgtaaaaaacttggtaaggatgggtacaatacaccaa-aa |
19701668 |
T |
 |
| Q |
169 |
tggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
||||||| ||||||||| ||||| || |||||||||||||||||||||| || | |||||||| |
|
|
| T |
19701669 |
tggtggggccccttcccggaccctgcgtatgcgggagctttagtgcaccaggctacccttttt |
19701731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 64 - 231
Target Start/End: Original strand, 8197038 - 8197203
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||| ||||||||||||||| |||| |||||||||||||||||| || || |||||||||||||||||| ||||||||| | |||| |||||| |
|
|
| T |
8197038 |
aactggtcaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggtaattgcctcttgtgtaaaaaacatggtaaggctacgtacagtacacc |
8197137 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|| ||||| |||||||||| | ||||| || |||| |||||||||||| ||||||||||||||||| |
|
|
| T |
8197138 |
aa--atggtaggaccccttctcggaccctgcgtatgttggagctttagtgtaccgggttgcccttttt |
8197203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 68 - 231
Target Start/End: Original strand, 35019229 - 35019389
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
167 |
Q |
| |
|
|||||||||||||||| | |||| |||||||| | ||||||| | |||||||||||||| |||||| ||| |||||||||||||||||||||||| |
|
|
| T |
35019229 |
ggtaaagttgttgtcacatgactgaaaggtcacagattcaagtcctgtaaacaacctcttgtataaaaatcagtataaggctgcatacaatacaccaat- |
35019327 |
T |
 |
| Q |
168 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|||||||||||| |||||||||| || |||||| |||||||||||||||||| |||| ||||| |
|
|
| T |
35019328 |
-tggtgggacccc-tcccagaccctgcgtatgcgagagctttagtgcaccgggctgccattttt |
35019389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 93 - 217
Target Start/End: Complemental strand, 45264534 - 45264411
Alignment:
| Q |
93 |
aaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagacccc |
192 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||| ||||||||| ||||||||| | ||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
45264534 |
aaggtcacatgttcaagtcctggaaacaacctcttgtgcaaaaaacagagtaaggctgtgtgcaatacaccaa-aatggtgggaccccttctcagaccct |
45264436 |
T |
 |
| Q |
193 |
gcatatgcgggagctttagtgcacc |
217 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
45264435 |
gcatatgcgggagctttagtgcacc |
45264411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 68 - 219
Target Start/End: Complemental strand, 2435946 - 2435796
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
167 |
Q |
| |
|
|||||||||||||||| || |||| |||||||||||||||||| ||||||| |||| ||||| ||||| |||||||| |||| ||||||||||||| | |
|
|
| T |
2435946 |
ggtaaagttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacagcctcctgtgtgaaaaatagggtaagcctgcgtacaatacaccaa-a |
2435848 |
T |
 |
| Q |
168 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgg |
219 |
Q |
| |
|
||||||||||||||| || |||| | ||||||||||||||||||||||| |
|
|
| T |
2435847 |
atggtgggacccctttccgtaccctccgcatgcgggagctttagtgcaccgg |
2435796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 114 - 231
Target Start/End: Original strand, 23796510 - 23796625
Alignment:
| Q |
114 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
213 |
Q |
| |
|
||||||| ||||||||||||||| || |||||| ||| ||||||||||||| |||||| ||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
23796510 |
ggaaacagcctcttgtgtaaaaatcaatgtaaggttgcgtacaatacaccaa--atggtgagaccccttcccagaccctgcatatgctggagctttagtg |
23796607 |
T |
 |
| Q |
214 |
caccgggttgcccttttt |
231 |
Q |
| |
|
||||||| |||||||||| |
|
|
| T |
23796608 |
caccgggctgcccttttt |
23796625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 114 - 231
Target Start/End: Complemental strand, 31382326 - 31382212
Alignment:
| Q |
114 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
213 |
Q |
| |
|
||||||| ||||||||||||||| |||| ||||||||| ||||||||||||| ||||||||||||||||| ||||| |||||||||||||||||| || |
|
|
| T |
31382326 |
ggaaacagcctcttgtgtaaaaa-caggataaggctgcgtacaatacaccaa--atggtgggaccccttcctggaccctgcatatgcgggagctttactg |
31382230 |
T |
 |
| Q |
214 |
caccgggttgcccttttt |
231 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
31382229 |
taccgggttgcccttttt |
31382212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 155 - 231
Target Start/End: Original strand, 50606487 - 50606563
Alignment:
| Q |
155 |
caatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50606487 |
caatacaccaaaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
50606563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 122 - 231
Target Start/End: Complemental strand, 1517417 - 1517309
Alignment:
| Q |
122 |
cctcttgtgt-aaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
220 |
Q |
| |
|
|||||||||| |||||||| | ||||||||| |||||||||||||| ||||||||||||||| ||||||| || ||||| ||||||||||||||||||| |
|
|
| T |
1517417 |
cctcttgtgttaaaaaacatgataaggctgcgtacaatacaccaat--tggtgggaccccttctcagaccctgcgtatgcaggagctttagtgcaccggg |
1517320 |
T |
 |
| Q |
221 |
ttgcccttttt |
231 |
Q |
| |
|
||||||||||| |
|
|
| T |
1517319 |
ttgcccttttt |
1517309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 68 - 219
Target Start/End: Complemental strand, 27136811 - 27136661
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
167 |
Q |
| |
|
|||||||||||||||| || | ||||||| |||| |||||||| || ||||||||||||||||||||||| ||||||| ||| ||||||||||||| | |
|
|
| T |
27136811 |
ggtaaagttgttgtcacgtgattggaaggacacgagttcaagttctgggaacaacctcttgtgtaaaaaacatggtaaggttgcgtacaatacaccaa-a |
27136713 |
T |
 |
| Q |
168 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgg |
219 |
Q |
| |
|
||||||||||||||||| ||| | | |||||||||||| |||||||||| |
|
|
| T |
27136712 |
atggtgggaccccttcctagatcatgtgtatgcgggagctccagtgcaccgg |
27136661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 68 - 209
Target Start/End: Original strand, 11596512 - 11596650
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
167 |
Q |
| |
|
|||||||| | |||||||| |||| || ||||||||||||||| |||||||||||||||||||||| |||||||||||||| || |||||||||| |
|
|
| T |
11596512 |
ggtaaagtggctgtcatgtgactgaaatgtcacgggttcaagtcctagaaacaacctcttgtgtaaaaa-cagggtaaggctgcgtataatacaccaa-- |
11596608 |
T |
 |
| Q |
168 |
atggtgggaccccttcccagaccccgcatatgcgggagcttt |
209 |
Q |
| |
|
||||||||||||||||| ||||| || |||||||||||||| |
|
|
| T |
11596609 |
atggtgggaccccttcctggaccctgcgtatgcgggagcttt |
11596650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 101 - 227
Target Start/End: Original strand, 22324925 - 22325049
Alignment:
| Q |
101 |
gggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgc |
200 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||| ||||||||||||||||||||||||||||| |||||||| |||| |||| ||||| || ||||| |
|
|
| T |
22324925 |
gggttcaagtcttggaaacagcctcttgtgtaaaa-acagggtaaggctgcatacaatacaccaaaaatggtggagccccgtccc-gaccctgcgtatgc |
22325022 |
T |
 |
| Q |
201 |
gggagctttagtgcaccgggttgccct |
227 |
Q |
| |
|
||||||||||||||||| || |||||| |
|
|
| T |
22325023 |
gggagctttagtgcaccaggctgccct |
22325049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 133 - 231
Target Start/End: Complemental strand, 42304303 - 42304205
Alignment:
| Q |
133 |
aaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
||||||||||||||| ||| |||||||||| || ||||||||||||||||||| ||||| || |||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
42304303 |
aaaaacagggtaaggttgcgtacaatacacaaaaaatggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcaccggattgcccttttt |
42304205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 67 - 230
Target Start/End: Complemental strand, 6983969 - 6983810
Alignment:
| Q |
67 |
tggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaat |
166 |
Q |
| |
|
||||||||||||||||| || |||| |||||||| ||||||||| ||||||| |||| || |||||||||||||||| ||| ||||||||||||| |
|
|
| T |
6983969 |
tggtaaagttgttgtcacgtgactgaaaggtcacaggttcaagtcctggaaacagcctc--gtataaaaaacagggtaagtatgcgtacaatacaccaa- |
6983873 |
T |
 |
| Q |
167 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
||||||||||||||| || ||||| || || || |||||||| |||||||||| ||||||||| |
|
|
| T |
6983872 |
-atggtgggacccctttccggaccctgcgtaggcaggagctttggtgcaccgggctgccctttt |
6983810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 69 - 226
Target Start/End: Complemental strand, 39215117 - 39214961
Alignment:
| Q |
69 |
gtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataa |
168 |
Q |
| |
|
|||||||| |||||| || ||| |||||| | |||||||| ||||||||||||||||||||||||| |||||||||||| ||||||| |||| || |
|
|
| T |
39215117 |
gtaaagttattgtcacgtgactaaaaggtcccaagttcaagtactggaaacaacctcttgtgtaaaaaactgggtaaggctgcgtacaatattccaa-aa |
39215019 |
T |
 |
| Q |
169 |
tggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccc |
226 |
Q |
| |
|
||||||| |||||||||| |||| || |||| || ||||||||||||||||| ||||| |
|
|
| T |
39215018 |
tggtgggtccccttcccaaaccctgcgtatgtggaagctttagtgcaccgggctgccc |
39214961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 135 - 231
Target Start/End: Original strand, 43768205 - 43768299
Alignment:
| Q |
135 |
aaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| || ||| ||||||||||| ||||||||| |||||||||| |
|
|
| T |
43768205 |
aaacagggtaaggctgcctacaatacaccaat--tggtgggaccccttcccagaccctgcgtatacgggagctttaatgcaccgggctgcccttttt |
43768299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 69 - 220
Target Start/End: Complemental strand, 44485267 - 44485119
Alignment:
| Q |
69 |
gtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataa |
168 |
Q |
| |
|
|||||||||||||||||| | || ||||||||||||| ||| |||||||||| ||||||||||| ||| ||||||||||| |||||||||||| || |
|
|
| T |
44485267 |
gtaaagttgttgtcatgtgattgaaaggtcacgggttatagtcctggaaacaaccacttgtgtaaaagacatggtaaggctgcgtacaatacacca--aa |
44485170 |
T |
 |
| Q |
169 |
tggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
220 |
Q |
| |
|
|||| |||||||||||| || || | |||||||||||||| |||||||||| |
|
|
| T |
44485169 |
tggttggaccccttcccggatcctacgtatgcgggagcttt-gtgcaccggg |
44485119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 67 - 227
Target Start/End: Complemental strand, 15511311 - 15511150
Alignment:
| Q |
67 |
tggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgc--atacaatacacca |
164 |
Q |
| |
|
||||||||||||||| |||| ||| |||||||| || |||| |||||| |||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
15511311 |
tggtaaagttgttgtaatgtggctgaaaggtcacatattgaagtcctggaaaccgcctcttgtgtaaaaaacagggtaaggctgcggatacaatacacca |
15511212 |
T |
 |
| Q |
165 |
ataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccct |
227 |
Q |
| |
|
| |||||||| ||||||||| ||||| || |||| | |||||||||||||||||| |||||| |
|
|
| T |
15511211 |
a-aatggtggtaccccttcctggaccctgcgtatgtgtgagctttagtgcaccgggctgccct |
15511150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 67 - 232
Target Start/End: Original strand, 20036218 - 20036381
Alignment:
| Q |
67 |
tggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaa-aaacagggtaaggctgcatacaatacaccaa |
165 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||||||| |||||||| |||||||||||| | | |||||||| ||| | |||||||||| |
|
|
| T |
20036218 |
tggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacaaactcttgtgtaaagagaaagggtaagattgcgttcaatacacca- |
20036316 |
T |
 |
| Q |
166 |
taatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttta |
232 |
Q |
| |
|
|||||||| |||||||||| ||||| || ||||| |||| ||| |||||||||| ||| ||||||| |
|
|
| T |
20036317 |
-aatggtggaaccccttcccggaccctgcgtatgcaggag-ttttgtgcaccgggctgctcttttta |
20036381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 134 - 226
Target Start/End: Complemental strand, 10378828 - 10378738
Alignment:
| Q |
134 |
aaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccc |
226 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||||||||| ||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
10378828 |
aaaacagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcttggaccctgcatatgcgggagctttagtgcaccgggctgccc |
10378738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 68 - 184
Target Start/End: Complemental strand, 17470505 - 17470390
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
167 |
Q |
| |
|
|||||||||||||||| || |||| | ||||| |||||||||| |||||| |||||||||||||||||||||||||||||| ||||||||||||| | |
|
|
| T |
17470505 |
ggtaaagttgttgtcacgtgactgaatggtcatgggttcaagtcctagaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaa-a |
17470407 |
T |
 |
| Q |
168 |
atggtgggaccccttcc |
184 |
Q |
| |
|
|| ||||||||| |||| |
|
|
| T |
17470406 |
atagtgggacccgttcc |
17470390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 71 - 175
Target Start/End: Original strand, 22327101 - 22327204
Alignment:
| Q |
71 |
aaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatg |
170 |
Q |
| |
|
|||||||||||||||| |||| |||||| ||||||||||| ||||||||||||||||||||||||||||||||||||| ||| || |||||| |||| |
|
|
| T |
22327101 |
aaagttgttgtcatgtgactgaaaggtcgcgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaaggctgtgtacgatgcaccaa-aatg |
22327199 |
T |
 |
| Q |
171 |
gtggg |
175 |
Q |
| |
|
||||| |
|
|
| T |
22327200 |
gtggg |
22327204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 68 - 180
Target Start/End: Original strand, 33222983 - 33223093
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
167 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||| || |||| | ||||||| |||||||||| |||||||||| |||| ||| ||||||||||||| | |
|
|
| T |
33222983 |
ggtaaagttgttgtcatgtgactgaaaggtcacggatttaagtcatggaaacagcctcttgtgt-aaaaacagggaaaggttgcgtacaatacaccaa-a |
33223080 |
T |
 |
| Q |
168 |
atggtgggacccc |
180 |
Q |
| |
|
||||||||||||| |
|
|
| T |
33223081 |
atggtgggacccc |
33223093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 68 - 231
Target Start/End: Original strand, 50811938 - 50812100
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaa-aacagggtaaggctgcatacaatacaccaat |
166 |
Q |
| |
|
|||||||||||||||| || |||| |||||||||| ||| || ||||||| | |||||||||||| |||||||||||| ||| ||||||||||||| |
|
|
| T |
50811938 |
ggtaaagttgttgtcacgtgactgaaaggtcacggaatcatgtcctggaaacagcttcttgtgtaaaaaaacagggtaaggttgcgtacaatacaccaa- |
50812036 |
T |
 |
| Q |
167 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|||||| |||||||||||| ||| || ||||||||||||||| ||||| ||| |||||||||| |
|
|
| T |
50812037 |
aatggt-ggaccccttcccgcgccctgcgtatgcgggagctttaatgcactgggctgcccttttt |
50812100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 66 - 165
Target Start/End: Complemental strand, 4430187 - 4430088
Alignment:
| Q |
66 |
ctggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaa |
165 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| |||| | ||||| ||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
4430187 |
ctggtaaagttgttgtcatgtgactggaaggtcacgggtttaagtcttgaaaacagtatcttgtgtaaaaaacagggtaagactgcgtacaatacaccaa |
4430088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 68 - 199
Target Start/End: Original strand, 25290162 - 25290300
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaa--acaacctcttgtgtaaaaaacagggtaaggc-----tgcatacaatac |
160 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||| |||||||| |||| ||| ||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
25290162 |
ggtaaagttgttgtcatgtgactgaaaggtcacgtgttcaagtcttggaaacacagcctcttgtgtaaaaaacagggtaaggcaaggttgtgtacaatac |
25290261 |
T |
 |
| Q |
161 |
accaataatggtgggaccccttcccagaccccgcatatg |
199 |
Q |
| |
|
||||| |||| | |||||||||||||||| | ||||||| |
|
|
| T |
25290262 |
accaaaaatgataggaccccttcccagactctgcatatg |
25290300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 22930230 - 22930114
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||| |||||||||| ||||||| ||| ||||||| |||||||||||||| || |||||||||| |
|
|
| T |
22930230 |
aactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacagccttttgtgta-aaaacagggtaaggttg-tgacaatacacc |
22930133 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcc |
184 |
Q |
| |
|
| |||||||||||||||||| |
|
|
| T |
22930132 |
a--aatggtgggaccccttcc |
22930114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 114 - 215
Target Start/End: Original strand, 43207540 - 43207640
Alignment:
| Q |
114 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
213 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||| | |||||||||||||||| | |||||||||| |||||||||||| |||||| ||||||||||| |
|
|
| T |
43207540 |
ggaaacaacctcttatgtgaaaaacagggtaagacggcatacaatacaccaa-attggtgggacctcttcccagaccctatgtatgcgagagctttagtg |
43207638 |
T |
 |
| Q |
214 |
ca |
215 |
Q |
| |
|
|| |
|
|
| T |
43207639 |
ca |
43207640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 125 - 230
Target Start/End: Complemental strand, 20999952 - 20999849
Alignment:
| Q |
125 |
cttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgc |
224 |
Q |
| |
|
||||||||||||||| || |||||||| |||||||||||| |||| |||| |||||||| |||| || || |||||||||||||||||||||| ||| |
|
|
| T |
20999952 |
cttgtgtaaaaaacaaggcaaggctgcgtacaatacacca--aatgatggggccccttccggcaccctgcgtacgcgggagctttagtgcaccgggctgc |
20999855 |
T |
 |
| Q |
225 |
cctttt |
230 |
Q |
| |
|
|||||| |
|
|
| T |
20999854 |
cctttt |
20999849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 132 - 222
Target Start/End: Complemental strand, 31442485 - 31442396
Alignment:
| Q |
132 |
aaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggtt |
222 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||| ||||||||||||||||||| ||| | | |||| ||||||||| |||||||||||| |
|
|
| T |
31442485 |
aaaaaacagggtaaggatgcgtacaatacaccaa-aatggtgggaccccttcccggacactgtgtatgtgggagctttggtgcaccgggtt |
31442396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 68 - 166
Target Start/End: Complemental strand, 50760385 - 50760287
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaat |
166 |
Q |
| |
|
|||||||| |||||||||| |||| ||||||||||||||||| | ||||| ||||||||||| ||||| |||||||||||| || ||||||||||| |
|
|
| T |
50760385 |
ggtaaagtagttgtcatgtgactgagaggtcacgggttcaagtcctgaaaacagcctcttgtgtataaaactgggtaaggctgcgtataatacaccaat |
50760287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 114 - 230
Target Start/End: Complemental strand, 19656219 - 19656104
Alignment:
| Q |
114 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
213 |
Q |
| |
|
||||||| |||||||||||||||||| ||||| ||| ||||||||||||| |||||| |||||| ||| ||||| |||||||| |||||||| || |
|
|
| T |
19656219 |
ggaaacagcctcttgtgtaaaaaacatggtaacgctatgtacaatacaccaa-aatggtaggaccctttcttggaccctgcatatgcaagagctttaatg |
19656121 |
T |
 |
| Q |
214 |
caccgggttgccctttt |
230 |
Q |
| |
|
||||||| ||||||||| |
|
|
| T |
19656120 |
caccgggctgccctttt |
19656104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 133 - 232
Target Start/End: Original strand, 6358185 - 6358283
Alignment:
| Q |
133 |
aaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttta |
232 |
Q |
| |
|
|||| |||||||| ||||| ||||| ||||||| ||||||||||||||||||||||||| || ||||| ||| |||||||| | ||| ||||||||||| |
|
|
| T |
6358185 |
aaaatcagggtaaagctgcgtacaaaacaccaa-aatggtgggaccccttcccagaccctgcgtatgcaggatctttagtgatcggggctgcccttttta |
6358283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 68 - 137
Target Start/End: Complemental strand, 2436052 - 2435983
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaa |
137 |
Q |
| |
|
|||||||||||||||| || |||| |||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
2436052 |
ggtaaagttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacaacctcctgtgtaaaaaa |
2435983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 167 - 224
Target Start/End: Complemental strand, 4587625 - 4587568
Alignment:
| Q |
167 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgc |
224 |
Q |
| |
|
||||||||||||||||||| ||||| || ||||||||||||| ||||||||||||||| |
|
|
| T |
4587625 |
aatggtgggaccccttcccggaccctgcctatgcgggagcttcagtgcaccgggttgc |
4587568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 169 - 230
Target Start/End: Complemental strand, 33594191 - 33594130
Alignment:
| Q |
169 |
tggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
||||||||||||||||||||||| || ||||||||||||||||||||| ||| | ||||||| |
|
|
| T |
33594191 |
tggtgggaccccttcccagaccctgcgtatgcgggagctttagtgcactgggctaccctttt |
33594130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 69 - 165
Target Start/End: Original strand, 24564344 - 24564440
Alignment:
| Q |
69 |
gtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaa |
165 |
Q |
| |
|
||||||||| |||| ||| | || |||||| | | ||||||| |||||||||||||||||||||||||||||||||| ||| |||||| |||||| |
|
|
| T |
24564344 |
gtaaagttgatgtcttgtgattgaaaggtcgcagattcaagtcttggaaacaacctcttgtgtaaaaaacagggtaagggtgcgtacaattcaccaa |
24564440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 115 - 227
Target Start/End: Complemental strand, 34679331 - 34679217
Alignment:
| Q |
115 |
gaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagac----cccgcatatgcgggagcttta |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| ||| ||||| || |||||||| |||| | |||||| || || ||||||||||||||| |
|
|
| T |
34679331 |
gaaacaacctcttgtgtaaaaaacagggtaagactgcgtactatacatca--aatggtggagccccgttccagacccggcctgcgtatgcgggagcttta |
34679234 |
T |
 |
| Q |
211 |
gtgcaccgggttgccct |
227 |
Q |
| |
|
|| ||||||| |||||| |
|
|
| T |
34679233 |
gtacaccgggctgccct |
34679217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 116 - 234
Target Start/End: Complemental strand, 20169200 - 20169084
Alignment:
| Q |
116 |
aaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgca |
215 |
Q |
| |
|
||||| |||||||||||||||| | |||||| ||| |||||||| ||||| |||||||| ||||||| ||||| ||||||||||||||||| ||| |
|
|
| T |
20169200 |
aaacaccctcttgtgtaaaaaaaaaggtaagactgtgtacaataccccaatc--ggtgggactccttcccggaccctgcatatgcgggagcttttgtgtc |
20169103 |
T |
 |
| Q |
216 |
ccgggttgccctttttagt |
234 |
Q |
| |
|
|| || |||||||| |||| |
|
|
| T |
20169102 |
cctggctgccctttatagt |
20169084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 137 - 218
Target Start/End: Original strand, 15505632 - 15505710
Alignment:
| Q |
137 |
acagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
218 |
Q |
| |
|
|||||||||| |||| ||||||||||||| |||||||||||||||||| |||| || |||||||||||||| |||||||| |
|
|
| T |
15505632 |
acagggtaagactgcgtacaatacaccaa--atggtgggaccccttcccgaaccctgcgtatgcgggagcttt-gtgcaccg |
15505710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 88 - 230
Target Start/End: Complemental strand, 19974213 - 19974073
Alignment:
| Q |
88 |
actggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccag |
187 |
Q |
| |
|
|||| ||| |||||||||||||| ||||||| |||| ||||||||| |||| |||| ||| ||||||||||||| |||| |||||||| ||||| | |
|
|
| T |
19974213 |
actgaaagatcacgggttcaagtcttggaaacagcctcaagtgtaaaaat-agggcaaggttgcgtacaatacaccaa-aatgatgggacccattcccgg |
19974116 |
T |
 |
| Q |
188 |
accccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
|| | ||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
19974115 |
actctatgtatgcgggagctttagtgcacggggctgccctttt |
19974073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 88 - 220
Target Start/End: Original strand, 23371143 - 23371271
Alignment:
| Q |
88 |
actggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccag |
187 |
Q |
| |
|
|||| |||||||||||||||||| |||||| || |||| ||||||||| ||| |||| || ||||||||||||| ||| ||||||||||||| || |
|
|
| T |
23371143 |
actgaaaggtcacgggttcaagtcctagaaacagccacttgggtaaaaaac-gggcaaggttgtgtacaatacaccaa--atgctgggaccccttcc-ag |
23371238 |
T |
 |
| Q |
188 |
accccgcatatgcgggagctttagtgcaccggg |
220 |
Q |
| |
|
|||| || |||| || ||||||||||||||||| |
|
|
| T |
23371239 |
accctgcgtatgtggtagctttagtgcaccggg |
23371271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 141 - 217
Target Start/End: Original strand, 7074588 - 7074663
Alignment:
| Q |
141 |
ggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
217 |
Q |
| |
|
|||| |||||| ||||||||||||| ||| |||||||| ||| | |||||| |||||| |||||||||||||||||| |
|
|
| T |
7074588 |
ggtatggctgcgtacaatacaccaa-aattgtgggacctctttctagaccctgcatatccgggagctttagtgcacc |
7074663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 167 - 231
Target Start/End: Original strand, 30555211 - 30555275
Alignment:
| Q |
167 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
||||||||||||||||| | ||||| || |||||| |||||||||||||||||| || ||||||| |
|
|
| T |
30555211 |
aatggtgggaccccttcacggaccctgcgtatgcgagagctttagtgcaccgggctgaccttttt |
30555275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 64 - 120
Target Start/End: Original strand, 34714618 - 34714674
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaaca |
120 |
Q |
| |
|
||||||||||||||||||||||| | || |||||||||||||||||| | ||||||| |
|
|
| T |
34714618 |
aactggtaaagttgttgtcatgtgattgaaaggtcacgggttcaagtcatggaaaca |
34714674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 114 - 220
Target Start/End: Complemental strand, 34149073 - 34148969
Alignment:
| Q |
114 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
213 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||||| ||| ||||| | |||| ||||||| |||||||||| ||||| |||||||| ||||| ||||| |
|
|
| T |
34149073 |
ggaaacagcctcttgtgtagaaaatagggtaaggttgcgtacaaaagacca--aatggtgagaccccttcctggaccctgcatatgcaggagcgctagtg |
34148976 |
T |
 |
| Q |
214 |
caccggg |
220 |
Q |
| |
|
|| |||| |
|
|
| T |
34148975 |
caacggg |
34148969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 132 - 231
Target Start/End: Original strand, 46859129 - 46859227
Alignment:
| Q |
132 |
aaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||| ||||||||||| | || ||| || || |||| ||||| |||||||||||||| | |||||||| |
|
|
| T |
46859129 |
aaaaaacagggtaagactgcgtacaatacaccaa-aatggtgggactcattttcaggccttgcgtatgtgggagttttagtgcaccgggcttcccttttt |
46859227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 79 - 231
Target Start/End: Complemental strand, 31272522 - 31272379
Alignment:
| Q |
79 |
tgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggacc |
178 |
Q |
| |
|
||||| || |||| |||||||| ||||||||| ||||||||||||||||||| |||||| ||||||||||| |||| ||| || ||||||||| |
|
|
| T |
31272522 |
tgtcacgtgactgaaaggtcacaggttcaagtcctggaaacaacctcttgtgta-aaaacatggtaaggctgcgtacagcacatca--aatggtggg--- |
31272429 |
T |
 |
| Q |
179 |
ccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
| || ||||| || |||||||||||||||||| || ||| |||||||||| |
|
|
| T |
31272428 |
---ttccggaccctgcgtatgcgggagctttagtggactgggctgcccttttt |
31272379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 64 - 110
Target Start/End: Original strand, 40424737 - 40424783
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagt |
110 |
Q |
| |
|
||||||||||||||||||||||| |||| |||| ||||||||||||| |
|
|
| T |
40424737 |
aactggtaaagttgttgtcatgtgactgaaaggccacgggttcaagt |
40424783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 68 - 226
Target Start/End: Original strand, 52910216 - 52910379
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgt-aaaaaacagggtaaggctgcatacaatacaccaa- |
165 |
Q |
| |
|
||||||||||||||||||| |||| |||||||| ||||||| | ||||||| |||||| || ||||||||||||| | ||| ||||||||||| | |
|
|
| T |
52910216 |
ggtaaagttgttgtcatgtgactgaaaggtcacaggttcaactcttggaaacagcctcttaggtaaaaaaacagggtaggactgtgtacaatacacctaa |
52910315 |
T |
 |
| Q |
166 |
---taatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccc |
226 |
Q |
| |
|
| ||||||||||||||||| || || | |||| |||| |||||||||||| || ||||| |
|
|
| T |
52910316 |
tggttatggtgggaccccttcctggaacctccgtatgtgggaactttagtgcaccaggctgccc |
52910379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 174 - 231
Target Start/End: Original strand, 16120819 - 16120876
Alignment:
| Q |
174 |
ggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|||||||||||| | ||| |||||||||||||||||| |||||| || |||||||||| |
|
|
| T |
16120819 |
ggaccccttcccggcccctgcatatgcgggagctttaatgcaccaggctgcccttttt |
16120876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 167 - 217
Target Start/End: Original strand, 1693222 - 1693273
Alignment:
| Q |
167 |
aatggtgggaccccttcccagaccccgcatatgcgggagc-tttagtgcacc |
217 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||| ||||| ||||||||||| |
|
|
| T |
1693222 |
aatggtgggaccccttcccagacccggcagatgcaggagcttttagtgcacc |
1693273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 193 - 232
Target Start/End: Complemental strand, 21773675 - 21773636
Alignment:
| Q |
193 |
gcatatgcgggagctttagtgcaccgggttgcccttttta |
232 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
21773675 |
gcatatgtgggagctttggtgcaccgggttgcccttttta |
21773636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 176 - 226
Target Start/End: Complemental strand, 28894611 - 28894561
Alignment:
| Q |
176 |
accccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccc |
226 |
Q |
| |
|
||||||||| |||||| ||||||||| ||||||||||||||| || ||||| |
|
|
| T |
28894611 |
accccttcctagaccctgcatatgcgagagctttagtgcaccaggctgccc |
28894561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 133 - 185
Target Start/End: Complemental strand, 21910743 - 21910693
Alignment:
| Q |
133 |
aaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttccc |
185 |
Q |
| |
|
||||| ||||||||| ||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
21910743 |
aaaaatagggtaaggttgcgtacaatacacca--aatggtgggaccccttccc |
21910693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 187 - 232
Target Start/End: Original strand, 24564450 - 24564495
Alignment:
| Q |
187 |
gaccccgcatatgcgggagctttagtgcaccgggttgcccttttta |
232 |
Q |
| |
|
||||| || ||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
24564450 |
gaccctgcctatgcaggagcgttagtgcaccgggttgcccttttta |
24564495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 115 - 156
Target Start/End: Original strand, 25027989 - 25028030
Alignment:
| Q |
115 |
gaaacaacctcttgtgtaaaaaacagggtaaggctgcataca |
156 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
25027989 |
gaaacagcctcttgtgtaaaaaacgaggtaaggctgcataca |
25028030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 167 - 231
Target Start/End: Complemental strand, 41440664 - 41440600
Alignment:
| Q |
167 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|||||||| ||||||||| |||| | | |||||||||||||||||| ||||| |||||||||| |
|
|
| T |
41440664 |
aatggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttttt |
41440600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 196 - 232
Target Start/End: Complemental strand, 50760273 - 50760237
Alignment:
| Q |
196 |
tatgcgggagctttagtgcaccgggttgcccttttta |
232 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
50760273 |
tatgcgggagctttaatgcaccgggctgcccttttta |
50760237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 132; Significance: 2e-68; HSPs: 61)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 64 - 231
Target Start/End: Complemental strand, 7136692 - 7136525
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |||||||||| ||||||||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
7136692 |
aactggtaaagttgttgtcatgtgactggaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaaaccagggtaaggctgcgtacaatacacc |
7136593 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
7136592 |
aataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttacccttttt |
7136525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 64 - 231
Target Start/End: Original strand, 6760794 - 6760961
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||| | ||| ||||||||||||||||||| ||||||| |||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
6760794 |
aactggtaaagttgttgtcatatgactagaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggcttcgtacaatacacc |
6760893 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6760894 |
aataatggtgggaccccttctcggaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
6760961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 118; E-Value: 5e-60
Query Start/End: Original strand, 62 - 230
Target Start/End: Original strand, 26954102 - 26954271
Alignment:
| Q |
62 |
gtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaa-aacagggtaaggctgcatacaatac |
160 |
Q |
| |
|
|||| |||||||||||||||||||| | | ||||||||||||||||||| ||||||| |||||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
26954102 |
gtaattggtaaagttgttgtcatgtgattagaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaaacagggtaaggctgcgtacaatac |
26954201 |
T |
 |
| Q |
161 |
accaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
26954202 |
accaataatggtgggaccccttcccagacctcgcatatgcgggagctttagtgcactgggttgccctttt |
26954271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 115; E-Value: 3e-58
Query Start/End: Original strand, 64 - 230
Target Start/End: Complemental strand, 39461159 - 39460993
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||||||||||| ||||||| ||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
39461159 |
aactggtaaagttgttgtcatgagactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagagtaaggctgcgtacaatacacc |
39461060 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
|||||||||| ||||||||||| ||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
39461059 |
aataatggtgagaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
39460993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 64 - 232
Target Start/End: Complemental strand, 28817789 - 28817623
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
28817789 |
aactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacacc |
28817690 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttta |
232 |
Q |
| |
|
||||||||||||||||||| ||||| || |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
28817689 |
--caatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcatcgggttgcccttttta |
28817623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 62 - 230
Target Start/End: Original strand, 36720766 - 36720932
Alignment:
| Q |
62 |
gtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaataca |
161 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
36720766 |
gtaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaataca |
36720865 |
T |
 |
| Q |
162 |
ccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
||| ||||||||||||||||||| ||||| || ||||||| |||||||||||||| |||||||||||| |
|
|
| T |
36720866 |
cca--aatggtgggaccccttcccggaccctgcgtatgcggaagctttagtgcacccggttgccctttt |
36720932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 64 - 232
Target Start/End: Original strand, 25250494 - 25250662
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |||||||| ||||||| ||| |||||||||||| |||||| |||||| ||||||||||| |
|
|
| T |
25250494 |
aactggtaaagttgttgtcatgtgactggaaggtcacatgttcaagtcctggaaacagcctattgtgtaaaaaatagggtatggctgcgtacaatacacc |
25250593 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttta |
232 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
25250594 |
aataatggtgggaccccttcccgaaccccgcatatgcgggagatttagtgcaccgggttgcccttttta |
25250662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 64 - 230
Target Start/End: Original strand, 44530121 - 44530285
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
|||||||||||||| |||||||| ||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
44530121 |
aactggtaaagttgctgtcatgtgactagaaggtcacgggttcaagtcttggaaacaacctcttgtgtaaaaaacagggtaaggctgcgtacaatacacc |
44530220 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
| |||||||||||||||||| ||||| || |||||||||||||||||||||||||||| |||||| |
|
|
| T |
44530221 |
a--aatggtgggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttgacctttt |
44530285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 64 - 231
Target Start/End: Original strand, 35261651 - 35261816
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||| ||||||| ||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
35261651 |
aactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagccctggaaacagtctcttgtgtaaaaaacagggtaaggttgcgtacaatacacc |
35261750 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|| ||||||||||||||||| ||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
35261751 |
aa--atggtgggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttgcccttttt |
35261816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 64 - 231
Target Start/End: Complemental strand, 12670411 - 12670248
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||||| ||||||| |||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
12670411 |
aactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacacc |
12670314 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|| |||||||||||||||||| ||||| ||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
12670313 |
aa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttacccttttt |
12670248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 64 - 229
Target Start/End: Complemental strand, 29521848 - 29521685
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||| ||||||||||||| ||| ||||||||||||||||||||||| ||||||| |||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
29521848 |
aactgataaagttgttgtcgtgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtttaaaaaacagggtaaggctgcgtacaatacacc |
29521749 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
| |||||||||| ||| |||||||||| || ||||||||||||||||||||||||||||| |||| |
|
|
| T |
29521748 |
a--aatggtgggaacccatcccagaccctgcgtatgcgggagctttagtgcaccgggttgctcttt |
29521685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 114 - 231
Target Start/End: Original strand, 20869945 - 20870062
Alignment:
| Q |
114 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
213 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
20869945 |
ggaaacagtctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttccaggaccccgcatatgcgggagctttagtg |
20870044 |
T |
 |
| Q |
214 |
caccgggttgcccttttt |
231 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
20870045 |
caccgggttgcccttttt |
20870062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 64 - 231
Target Start/End: Complemental strand, 30454258 - 30454095
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||||| ||||||| |||||||||||||| || ||||||||||| ||| ||||||| |
|
|
| T |
30454258 |
aactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaa--caaggtaaggctgcgtacgatacacc |
30454161 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|| |||||||||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30454160 |
aa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttttt |
30454095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 64 - 231
Target Start/End: Complemental strand, 8897927 - 8897762
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| || | ||||||||||||| |||| |||||||||| ||||||||||||| ||||||||||| | ||||||||||| |
|
|
| T |
8897927 |
aactggtaaagttgttgtcatgtgacagcaaggtcacgggttgaagtcctggaaacaaccgcttgtgtaaaaaatagggtaaggctacgtacaatacacc |
8897828 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
| ||||||||||||||||||| ||||| |||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
8897827 |
a--aatggtgggaccccttcccggaccctgcatatgcgggagctttactgcacccggttgcccttttt |
8897762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 64 - 230
Target Start/End: Original strand, 12625861 - 12626026
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaa-cagggtaaggctgcatacaatacac |
162 |
Q |
| |
|
||||||||||||||||||| ||| ||| | |||||||||| |||||| |||||||||||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
12625861 |
aactggtaaagttgttgtcgtgtgacttgtaggtcacgggctcaagtcctggaaacaacctcttgtgtaaaaaaacagggtaagactgcatacaatacac |
12625960 |
T |
 |
| Q |
163 |
caataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
||| ||||||||||||| |||| ||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
12625961 |
caa--atggtgggaccccctcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
12626026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 64 - 229
Target Start/End: Original strand, 13160674 - 13160836
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||||| |||||| ||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
13160674 |
aactggtaaagttgttgtcatgtgactgtaaggtcacgggttcaagtcctagaaacagcctcttgtgtaaaaa-cagggtaaggctgcgtacaatacacc |
13160772 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
|| |||||||||||||||||| ||||| || ||||||||||||| ||||| |||||||||||||| |
|
|
| T |
13160773 |
aa--atggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcgccgggttgcccttt |
13160836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 68 - 223
Target Start/End: Complemental strand, 20284232 - 20284075
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaaca--gggtaaggctgcatacaatacaccaa |
165 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||||||| ||||||| |||||||| ||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
20284232 |
ggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaaaaaagggtaaggctgcgtacaatacaccaa |
20284133 |
T |
 |
| Q |
166 |
taatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttg |
223 |
Q |
| |
|
|||||||||||||||||||| ||||| || |||||||||| ||||||||||||||||| |
|
|
| T |
20284132 |
taatggtgggaccccttcccggaccctgcgtatgcgggagttttagtgcaccgggttg |
20284075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 68 - 223
Target Start/End: Complemental strand, 21070861 - 21070703
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaaca---gggtaaggctgcatacaatacacca |
164 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||||||| ||||||| |||||||| ||||||| | |||||||||||| |||||||||||| |
|
|
| T |
21070861 |
ggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaaaaaaagggtaaggctgcgtacaatacacca |
21070762 |
T |
 |
| Q |
165 |
ataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttg |
223 |
Q |
| |
|
||||||||||||||||||||| ||||| || |||||||||| ||||||||||||||||| |
|
|
| T |
21070761 |
ataatggtgggaccccttcccggaccctgcgtatgcgggagttttagtgcaccgggttg |
21070703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 65 - 228
Target Start/End: Original strand, 45071238 - 45071398
Alignment:
| Q |
65 |
actggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacca |
164 |
Q |
| |
|
|||||||||||||||||||||| | || |||||||||||||||||| ||||||| |||||||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
45071238 |
actggtaaagttgttgtcatgtgattgtaaggtcacgggttcaagttctggaaacagcctcttgtgt-aaaaacagggtaaggctgcgtacaatacacca |
45071336 |
T |
 |
| Q |
165 |
ataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctt |
228 |
Q |
| |
|
||||||||||||||||||| |||| || ||||||||||||| ||||||||||||||||||| |
|
|
| T |
45071337 |
--aatggtgggaccccttcccggaccttgcgtatgcgggagcttcagtgcaccgggttgccctt |
45071398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 68 - 216
Target Start/End: Complemental strand, 44781665 - 44781517
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
167 |
Q |
| |
|
|||||||||||||||| || |||| ||| |||||||||||||| |||||||||||||||||||||| |||||||||||||| ||||||||||||| | |
|
|
| T |
44781665 |
ggtaaagttgttgtcacgtgactgaaagttcacgggttcaagtcctggaaacaacctcttgtgtaaaagacagggtaaggctgtgtacaatacaccaaaa |
44781566 |
T |
 |
| Q |
168 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcac |
216 |
Q |
| |
|
||| ||||||||| |||||||||| || ||||||||||||||||||||| |
|
|
| T |
44781565 |
atgttgggaccccgtcccagaccctgcgtatgcgggagctttagtgcac |
44781517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 64 - 229
Target Start/End: Original strand, 17823548 - 17823711
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| || | |||||||||||||||||| ||||||| ||||||||||||||| |||| |||| |||| || |||||||| |
|
|
| T |
17823548 |
aactggtaaagttgttgtcatgtgaccgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaccaggataagactgcgtaaaatacacc |
17823647 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
| |||||||| |||||||||| |||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
17823648 |
a--aatggtggaaccccttcccgaaccctgcatatgcaggagctttagtgcaccgggttgcccttt |
17823711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 67 - 229
Target Start/End: Original strand, 2626494 - 2626657
Alignment:
| Q |
67 |
tggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgt---aaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
|||||||||||||||||||| || | |||||||||||||||||| ||||||| |||||||||| ||||||||||||||| |||| ||||||||||| |
|
|
| T |
2626494 |
tggtaaagttgttgtcatgtgaccgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaaaaacagggtaagactgcgtacaatacacc |
2626593 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
| |||| |||||||||||||||||||| |||||||||||||||| |||||||| | ||||||||| |
|
|
| T |
2626594 |
a--aatgatgggaccccttcccagaccctgcatatgcgggagcttcagtgcaccagattgcccttt |
2626657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 84; E-Value: 9e-40
Query Start/End: Original strand, 122 - 229
Target Start/End: Original strand, 16225049 - 16225156
Alignment:
| Q |
122 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
221 |
Q |
| |
|
|||||| |||||||||||||||||| |||| |||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
16225049 |
cctcttatgtaaaaaacagggtaagactgcgtacaatacaccaataatggtgggatcccttcccggaccccgcatatgcgggagctttagtgcaccgggt |
16225148 |
T |
 |
| Q |
222 |
tgcccttt |
229 |
Q |
| |
|
|| ||||| |
|
|
| T |
16225149 |
tgtccttt |
16225156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 96 - 220
Target Start/End: Complemental strand, 8484069 - 8483947
Alignment:
| Q |
96 |
gtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgca |
195 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||||||||| |||||||| |||||||||||||| |||||||||||| |||||||||| || |
|
|
| T |
8484069 |
gtcatgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggcaaggctgcgtacaatacaccaat--tggtgggaccccatcccagaccctgcg |
8483972 |
T |
 |
| Q |
196 |
tatgcgggagctttagtgcaccggg |
220 |
Q |
| |
|
|||||||||||||||| |||||||| |
|
|
| T |
8483971 |
tatgcgggagctttagggcaccggg |
8483947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 72 - 231
Target Start/End: Complemental strand, 18164914 - 18164758
Alignment:
| Q |
72 |
aagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatgg |
171 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||| ||||||| ||||||||||||||| |||||||||| ||| ||||||||||||| | | |
|
|
| T |
18164914 |
aagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaa-cagggtaaggttgcgtacaatacaccaa--agga |
18164818 |
T |
 |
| Q |
172 |
tgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|| |||| ||||| ||||| || |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
18164817 |
tgtgaccatttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccattttt |
18164758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 64 - 206
Target Start/End: Complemental strand, 20869659 - 20869523
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||||| ||||||| |||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
20869659 |
aactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgt--aaaacagggtaaggctgtgtacaatacacc |
20869562 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagc |
206 |
Q |
| |
|
|| |||| ||||||||||| ||||| |||||||||||||| |
|
|
| T |
20869561 |
aa----ggtgagaccccttcccggaccctgcatatgcgggagc |
20869523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 98 - 232
Target Start/End: Complemental strand, 5135418 - 5135287
Alignment:
| Q |
98 |
cacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcata |
197 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||||| |||||||||||| |||||||||||| ||||||||||||||||||| ||||| || || |
|
|
| T |
5135418 |
cacgggttcaagtcctggaaacagcctcttgtgtaaaaaagagggtaaggctgtgtacaatacacca--aatggtgggaccccttcccggaccctgcgta |
5135321 |
T |
 |
| Q |
198 |
tgcgggagctttagtgcaccgggttgcccttttta |
232 |
Q |
| |
|
||| |||||||| |||||||||| ||||||||||| |
|
|
| T |
5135320 |
tgcaggagcttt-gtgcaccgggctgcccttttta |
5135287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 114 - 227
Target Start/End: Original strand, 29877116 - 29877227
Alignment:
| Q |
114 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
213 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||| ||||| || ||||||||||| |||||| |
|
|
| T |
29877116 |
ggaaacagccttttgtgtaaaaaacagggtaaggctgcgtacaatacacca--aatggtgggaccccttcccggaccctgcgtatgcgggagcgttagtg |
29877213 |
T |
 |
| Q |
214 |
caccgggttgccct |
227 |
Q |
| |
|
|||| || |||||| |
|
|
| T |
29877214 |
caccaggctgccct |
29877227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 64 - 229
Target Start/End: Original strand, 28407388 - 28407538
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| |||||||||| ||||||||||||||| |||| |
|
|
| T |
28407388 |
aactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgt-aaaaacagggtaagg------------cacc |
28407474 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
| ||||||||||||||||||| ||||| | ||||||||||||||| |||||||||||||||||| |
|
|
| T |
28407475 |
a--aatggtgggaccccttcccggaccctacgtatgcgggagctttactgcaccgggttgcccttt |
28407538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 74 - 230
Target Start/End: Original strand, 31457155 - 31457308
Alignment:
| Q |
74 |
gttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtg |
173 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||||| | ||||||||||||||||||||| ||| |||||||| ||||||||| ||| ||||| |
|
|
| T |
31457155 |
gttgttgtcatgtggctgaaaggtcacgggttcaagtcctgtaaacaacctcttgtgtaaaaat-aggaaaaggctgcgtacaatacatcaa--atggta |
31457251 |
T |
 |
| Q |
174 |
ggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
||||||||||||| |||| || |||||||||||| ||||||||||| |||||||||| |
|
|
| T |
31457252 |
ggaccccttcccaaaccctgcgtatgcgggagctctagtgcaccggattgccctttt |
31457308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 68 - 232
Target Start/End: Complemental strand, 44742678 - 44742515
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
167 |
Q |
| |
|
||||||||||||||| || | || ||||||| | |||||||| |||||||| ||| ||||||||||||||||||||||||| ||||||||||||| | |
|
|
| T |
44742678 |
ggtaaagttgttgtcgcgtgattgtaaggtcatgagttcaagttctggaaacaatctcctgtgtaaaaaacagggtaaggctgcgtacaatacaccaa-a |
44742580 |
T |
 |
| Q |
168 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttta |
232 |
Q |
| |
|
|||||||||||||||| ||||| | |||||||||| ||||||||||||| ||||| ||||| |
|
|
| T |
44742579 |
atggtgggaccccttcttggaccctacggatgcgggagcattagtgcaccggggtgcccctttta |
44742515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 68 - 217
Target Start/End: Original strand, 22598133 - 22598279
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
167 |
Q |
| |
|
|||||||||||||||| | |||| |||||||||||||||| | |||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
22598133 |
ggtaaagttgttgtcacatgactgaaaggtcacgggttcaaatcctggaaacaacctcttgtgtaaaaaacagggtaaggctatgtacaatacaccaat- |
22598231 |
T |
 |
| Q |
168 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
217 |
Q |
| |
|
||||| ||||| ||||| |||| || ||||||||| |||||||||||| |
|
|
| T |
22598232 |
-tggtgagaccctttcccggaccttgcgtatgcggga-ctttagtgcacc |
22598279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 122 - 232
Target Start/End: Original strand, 10857858 - 10857967
Alignment:
| Q |
122 |
cctcttgtgtaaaaaa-cagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
220 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||| |||||||||| ||||| |||| || ||||||||||||||||||||||||| |
|
|
| T |
10857858 |
cctcttgtgtaaaaaaacagggtaaggctgcgcacaatacaccaat--tggtgggaccacttcctggaccttgcgtatgcgggagctttagtgcaccggg |
10857955 |
T |
 |
| Q |
221 |
ttgcccttttta |
232 |
Q |
| |
|
|||||||||||| |
|
|
| T |
10857956 |
ttgcccttttta |
10857967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 69 - 218
Target Start/End: Complemental strand, 24365218 - 24365071
Alignment:
| Q |
69 |
gtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaa-cagggtaaggctgcatacaatacaccaata |
167 |
Q |
| |
|
|||||||||||||||||| ||| || |||||||||||||| |||||| |||||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
24365218 |
gtaaagttgttgtcatgtgactaaaatgtcacgggttcaagccctagaaacagcctcttgtgtaaaaaatcagggtaaggctgcgaacaatacaccaa-- |
24365121 |
T |
 |
| Q |
168 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
218 |
Q |
| |
|
|||||||||||||||||| ||||| || |||| ||||||||| |||||||| |
|
|
| T |
24365120 |
atggtgggaccccttcccggaccctgcgtatgtgggagcttt-gtgcaccg |
24365071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 122 - 226
Target Start/End: Complemental strand, 17250982 - 17250879
Alignment:
| Q |
122 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
221 |
Q |
| |
|
|||||||||||||||||||| |||||| || ||||||||||||||||||||||||||| ||||| |||| || |||| |||||||||||||| ||||| |
|
|
| T |
17250982 |
cctcttgtgtaaaaaacaggttaaggcagcgtacaatacaccaataatggtgggaccctttcccgaaccctgcgtatgaaggagctttagtgca-cgggt |
17250884 |
T |
 |
| Q |
222 |
tgccc |
226 |
Q |
| |
|
||||| |
|
|
| T |
17250883 |
tgccc |
17250879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 153 - 232
Target Start/End: Original strand, 16013515 - 16013594
Alignment:
| Q |
153 |
tacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttta |
232 |
Q |
| |
|
|||||||||| || ||||||| ||||||||||||||||| || |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
16013515 |
tacaatacactaaaaatggtgcgaccccttcccagaccctgcctatgcgggagctttagtgcaccgggttgtccttttta |
16013594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 93 - 219
Target Start/End: Original strand, 389644 - 389770
Alignment:
| Q |
93 |
aaggtcacgggttcaagtgagggaaacaacctcttgtgt--aaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagacc |
190 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||| |||||||||||||||| ||| |||||||||||| |||| ||||| ||||| || |||| |
|
|
| T |
389644 |
aaggtcacgggttcaagtcctggaaacaccctcttgtgtcaaaaaaacagggtaaggttgcgtacaatacacca--aatgatgggatccctttcctgacc |
389741 |
T |
 |
| Q |
191 |
ccgcatatgcgggagctttagtgcaccgg |
219 |
Q |
| |
|
| || |||||| ||||||||||||||||| |
|
|
| T |
389742 |
ctgcgtatgcgagagctttagtgcaccgg |
389770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 134 - 230
Target Start/End: Original strand, 19729382 - 19729476
Alignment:
| Q |
134 |
aaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||||||||||||| ||||| |||||| |||||||| |||||||| || |||||||||| |
|
|
| T |
19729382 |
aaaacagggtaaggctgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatacgggagctctagtgcactggattgccctttt |
19729476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 71 - 184
Target Start/End: Original strand, 35105902 - 35106014
Alignment:
| Q |
71 |
aaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatg |
170 |
Q |
| |
|
||||||||||||| || ||| |||||||||||||||||| |||||||||||||||||||||| | || |||||||||| ||||||||||| | |||| |
|
|
| T |
35105902 |
aaagttgttgtcacgtggctgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaagagagtgtaaggctgcgtacaatacacc-agaatg |
35106000 |
T |
 |
| Q |
171 |
gtgggaccccttcc |
184 |
Q |
| |
|
|||||||| ||||| |
|
|
| T |
35106001 |
gtgggacctcttcc |
35106014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 116 - 189
Target Start/End: Original strand, 43942348 - 43942421
Alignment:
| Q |
116 |
aaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagac |
189 |
Q |
| |
|
||||| |||||| ||| ||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43942348 |
aaacagcctcttatgtcaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccagac |
43942421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 152 - 231
Target Start/End: Original strand, 26102577 - 26102654
Alignment:
| Q |
152 |
atacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||| || |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26102577 |
atacaatacaccaa--atggtgggaccccttcccggaccctgcttatgcgggagctctagtgcaccgggttgcccttttt |
26102654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 68 - 228
Target Start/End: Complemental strand, 42083858 - 42083699
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
167 |
Q |
| |
|
|||||| ||||||||| || |||| |||||||||||||||||| ||||||| ||| |||||||||||| ||| |||||||| |||| || ||||| | |
|
|
| T |
42083858 |
ggtaaaattgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacagccttttgtgtaaaaaatggggcaaggctgcgtacagtataccaa-a |
42083760 |
T |
 |
| Q |
168 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctt |
228 |
Q |
| |
|
|||||||||||||||||| |||| | || | ||||||||||||||| ||| ||||||| |
|
|
| T |
42083759 |
atggtgggaccccttcccgaaccctgtgtacgtgggagctttagtgcattgggctgccctt |
42083699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 122 - 224
Target Start/End: Original strand, 5689661 - 5689761
Alignment:
| Q |
122 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
221 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||| |||||||| |||||||||| ||| || |||| ||||||||||||||||||| | |
|
|
| T |
5689661 |
cctcttgtgtaaaaagcagggtaaggctgcgtacaatacacca--aatggtggaaccccttcccgaaccatgcgtatgtgggagctttagtgcaccggtt |
5689758 |
T |
 |
| Q |
222 |
tgc |
224 |
Q |
| |
|
||| |
|
|
| T |
5689759 |
tgc |
5689761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 64 - 185
Target Start/End: Original strand, 11748271 - 11748392
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||| || |||||||||||| |||| || ||||||||||||||| ||||||| |||||| |||||||| ||||||||| | || ||||||| || |
|
|
| T |
11748271 |
aactggtgaaattgttgtcatgtgactgaaatgtcacgggttcaagtcttggaaacagcctcttttgtaaaaagcagggtaagacagcgtacaatataca |
11748370 |
T |
 |
| Q |
164 |
aataatggtgggaccccttccc |
185 |
Q |
| |
|
|| |||||| |||||||||||| |
|
|
| T |
11748371 |
aaaaatggtaggaccccttccc |
11748392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 78 - 229
Target Start/End: Complemental strand, 23000365 - 23000228
Alignment:
| Q |
78 |
ttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggac |
177 |
Q |
| |
|
||||||||| |||| |||||||||||| |||| ||||||| ||||||||||||||| || ||||||| | |||||||||||||| ||||||||||| |
|
|
| T |
23000365 |
ttgtcatgtgactgaaaggtcacgggt--aagtcctggaaacagcctcttgtgtaaaaa-cacggtaaggttccatacaatacacca--aatggtgggac |
23000271 |
T |
 |
| Q |
178 |
cccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
23000270 |
cccttcccgg---------atgcgggagctttagtgcaccgggttgcccttt |
23000228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 64 - 230
Target Start/End: Complemental strand, 40605068 - 40604905
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| | |||| | | | |||||||||| | |||||||| || |||||||||||| || ||||| ||| |||||||||| |
|
|
| T |
40605068 |
aactggtaaagttgttgtcatgtgattggatgattatgggttcaagtcatggaaacaatcttttgtgtaaaaaattggataaggttgcgtacaatacact |
40604969 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
| |||| | ||| ||||||| | |||| | ||||||||||||||||||||||| |||||||||| |
|
|
| T |
40604968 |
a--aatgat-ggatcccttccgaaaccctacgtatgcgggagctttagtgcaccgaattgccctttt |
40604905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 68 - 208
Target Start/End: Complemental strand, 14018128 - 14017989
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
167 |
Q |
| |
|
||||| |||||||||| || | || ||||||| |||||||||| ||||||| ||||||||||||||||||||| || |||| |||||||||| || | |
|
|
| T |
14018128 |
ggtaatgttgttgtcacgtgattgaaaggtcatgggttcaagtcttggaaacagtctcttgtgtaaaaaacagggtgagactgcgtacaatacactaa-a |
14018030 |
T |
 |
| Q |
168 |
atggtgggaccccttcccagaccccgcatatgcgggagctt |
208 |
Q |
| |
|
|||||||||| ||||| ||||| ||| |||||| ||||| |
|
|
| T |
14018029 |
ttggtgggaccacttcctggaccctgcagatgcggtagctt |
14017989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 64 - 210
Target Start/End: Original strand, 24245423 - 24245565
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||||| |||||| ||||| ||| ||||||||||| || | |||||| |||| |
|
|
| T |
24245423 |
aactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaac-gtctcttatgt----aacagggtaagactacgtacaatgcacc |
24245517 |
T |
 |
| Q |
164 |
-aataatggtgggaccccttcccagaccccgcatatgcgggagcttta |
210 |
Q |
| |
|
|| ||| |||||||||||||| ||||| || ||||||||||||||| |
|
|
| T |
24245518 |
aaaaaattgtgggaccccttcctggaccctgcgtatgcgggagcttta |
24245565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 116 - 229
Target Start/End: Original strand, 33866973 - 33867087
Alignment:
| Q |
116 |
aaacaacctcttgtgtaaaaaa-cagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgc |
214 |
Q |
| |
|
||||||| | |||||||||||| ||||||||| |||||||||||||| || ||||||| || |||||| |||| || ||||| | ||||||||||| |
|
|
| T |
33866973 |
aaacaactttttgtgtaaaaaagcagggtaagactgcatacaatacataaaaaatggtgacacttcttcccgaaccctgcgtatgcagaagctttagtgc |
33867072 |
T |
 |
| Q |
215 |
accgggttgcccttt |
229 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
33867073 |
accgggttgcccttt |
33867087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 180 - 231
Target Start/End: Complemental strand, 27468141 - 27468090
Alignment:
| Q |
180 |
cttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|||||| ||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
27468141 |
cttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttttt |
27468090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 169 - 228
Target Start/End: Original strand, 27507985 - 27508044
Alignment:
| Q |
169 |
tggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctt |
228 |
Q |
| |
|
||||||||||||||||| |||| || |||||||||||||||||||||||||||| |||| |
|
|
| T |
27507985 |
tggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgtcctt |
27508044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 167 - 230
Target Start/End: Complemental strand, 35107373 - 35107310
Alignment:
| Q |
167 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
||||||||||||||||||| ||| | | ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
35107373 |
aatggtgggaccccttcccggacgctgtgtatgcggaagctttagtgcaccgggttgccctttt |
35107310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 70 - 165
Target Start/End: Original strand, 36918102 - 36918197
Alignment:
| Q |
70 |
taaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaa |
165 |
Q |
| |
|
|||| ||||||| ||| ||||| |||||||| |||||||| |||||||| |||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
36918102 |
taaaattgttgttatggaactgaaaggtcacatgttcaagttctggaaacaatttcttatgtaaaaaacagggtaaggctgtgtacaatacaccaa |
36918197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 139 - 231
Target Start/End: Original strand, 26457776 - 26457864
Alignment:
| Q |
139 |
agggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||||||||| || |||| || |||| |||||||||||||||||||||| || ||||| |
|
|
| T |
26457776 |
agggtaaggctgcgtacaatacaccaat--tggtgggacccct--cctgaccttgcgtatgagggagctttagtgcaccgggtttcctttttt |
26457864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 71 - 151
Target Start/End: Complemental strand, 30962929 - 30962849
Alignment:
| Q |
71 |
aaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgc |
151 |
Q |
| |
|
|||||||||||||||| | || ||||||||| ||||||| ||||||| |||||||||||||||| ||||| ||||||| |
|
|
| T |
30962929 |
aaagttgttgtcatgtgattgaaaggtcacgacttcaagtcctggaaacagcctcttgtgtaaaaaatagggttaggctgc |
30962849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 68 - 181
Target Start/End: Complemental strand, 11001109 - 11000997
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgt-aaaaaacagggtaaggctgcatacaatacaccaat |
166 |
Q |
| |
|
||||||||||||||||||| | || |||||| ||||||||| | | ||||||||| ||||| |||||||| | |||||||| |||||||||||| |
|
|
| T |
11001109 |
ggtaaagttgttgtcatgtgattgaaaggtcgcgggttcaaattctgaaaacaacctactgtgtaaaaaaacaagataaggctgtgtacaatacacca-- |
11001012 |
T |
 |
| Q |
167 |
aatggtgggacccct |
181 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
11001011 |
aatggtgggacccct |
11000997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 168 - 228
Target Start/End: Complemental strand, 36486627 - 36486567
Alignment:
| Q |
168 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctt |
228 |
Q |
| |
|
||||||||||| |||||| |||| || ||||| ||||||||||||| ||||||||||||| |
|
|
| T |
36486627 |
atggtgggacctcttcccggaccttgcgtatgcaggagctttagtgccccgggttgccctt |
36486567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 67 - 110
Target Start/End: Complemental strand, 40607884 - 40607841
Alignment:
| Q |
67 |
tggtaaagttgttgtcatgtaactggaaggtcacgggttcaagt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| | |||||||| |
|
|
| T |
40607884 |
tggtaaagttgttgtcatgtaactggaatgtcatgagttcaagt |
40607841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 187 - 229
Target Start/End: Complemental strand, 23286379 - 23286337
Alignment:
| Q |
187 |
gaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
23286379 |
gaccctgcatatgcgggagctctagtgcaccgggctgcccttt |
23286337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 167 - 231
Target Start/End: Complemental strand, 2351780 - 2351719
Alignment:
| Q |
167 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
||||||||||||| |||| |||||| |||| |||||||||||||||||||| |||| ||||||| |
|
|
| T |
2351780 |
aatggtgggaccc-ttcctagaccctgcat--gcgggagctttagtgcaccgagttgtccttttt |
2351719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 174 - 231
Target Start/End: Original strand, 18595918 - 18595975
Alignment:
| Q |
174 |
ggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|||||||||||| ||||| | |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
18595918 |
ggaccccttcccggaccctgtgtatgcgggagttttagtgcatcgggttgcctttttt |
18595975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 132; Significance: 2e-68; HSPs: 95)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 64 - 231
Target Start/End: Complemental strand, 16408766 - 16408599
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
16408766 |
aactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacacc |
16408667 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16408666 |
aataatggtggaaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
16408599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 64 - 226
Target Start/End: Original strand, 21646936 - 21647098
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| ||||||||| ||||||| |||||||||||||||| ||||||||||||| ||||||| ||| |
|
|
| T |
21646936 |
aactggtaaagttgttgtcatgtgactggaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaaaatagggtaaggctgcgtacaatatacc |
21647035 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccc |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21647036 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccc |
21647098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 64 - 231
Target Start/End: Original strand, 23501765 - 23501926
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||||| | || |||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
23501765 |
aactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtca------cagcctcttgtgtaaaaaacagggtaaggttgcgtacaatacacc |
23501858 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23501859 |
aataatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
23501926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 64 - 233
Target Start/End: Complemental strand, 13256560 - 13256395
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| ||||||||| ||| |||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
13256560 |
aactggtaaagttgttgtcatgtgactggaaggtcataggttcaagtcctggag----cctcttgtgtaaaaaacagggtaaggctgcgtacaatacacc |
13256465 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttttag |
233 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
13256464 |
aataatagtgggaccccttcccgaaccccgcatctgcgggagctttagtgcaccgggttgccctttttag |
13256395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 64 - 229
Target Start/End: Original strand, 20224956 - 20225117
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||| |||||||||| |||||||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
20224956 |
aactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaa--cagggtaaggctgcgtacaatacacc |
20225053 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
|| |||||||||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
20225054 |
aa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
20225117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 64 - 232
Target Start/End: Original strand, 5648231 - 5648396
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||||| ||||||| |||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
5648231 |
aactggtaaagttgttgtcatgtgactgtaaggtcacgggttcaagtcctggaaacagcctcttgtgt-aaaaacagggtaaggctgcgtacaatacacc |
5648329 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttta |
232 |
Q |
| |
|
| ||||||||||||||||||| ||||| || ||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
5648330 |
a--aatggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcactgggttgcccttttta |
5648396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 64 - 228
Target Start/End: Complemental strand, 6430788 - 6430627
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||||| | ||||||| ||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
6430788 |
aactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcatggaaacagcctcttgtgta-aaaacagggtaaggctgcgtacaatacacc |
6430690 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctt |
228 |
Q |
| |
|
| |||||||||||| |||||| ||||| || |||||||||||||||| |||||||||||||||| |
|
|
| T |
6430689 |
a--aatggtgggaccacttcccggaccctgcgtatgcgggagctttagcgcaccgggttgccctt |
6430627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 243 - 365
Target Start/End: Original strand, 33049064 - 33049187
Alignment:
| Q |
243 |
taaaaataatatttct-aactgaagttcaaaataagtaactcaagaccagttttttacatgtaactcttgcatatcctaagcactccataccttgaaccg |
341 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33049064 |
taaaaataatatttcttaagtgaagttcaaaataagtaactgaagaccagttttttacatgtaactcttgcatatcctaagcactccataccttgaacca |
33049163 |
T |
 |
| Q |
342 |
cacactgtttcaaatgtctctgct |
365 |
Q |
| |
|
||||||||||||||||||| |||| |
|
|
| T |
33049164 |
cacactgtttcaaatgtctttgct |
33049187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 64 - 230
Target Start/End: Original strand, 16911534 - 16911700
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||||||||||||| |||||| ||||||||||| ||| |||||||||||||| ||||||||||| |
|
|
| T |
16911534 |
aactggtaaagttgttgtcatgtgacttaaaggtcacgggttcaagtcctagaaacagcctcttgtgtacaaatcagggtaaggctgcgtacaatacacc |
16911633 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
|||||||||||||||||||||| ||||| || || |||||||||||||| |||||||||||||||| |
|
|
| T |
16911634 |
aataatggtgggaccccttcccggaccctgcgtacgcgggagctttagtttaccgggttgccctttt |
16911700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 64 - 231
Target Start/End: Complemental strand, 48598986 - 48598823
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||||| ||||||| |||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
48598986 |
aactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaatacacc |
48598889 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
| ||||||||||||||||||| |||| |||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
48598888 |
a--aatggtgggaccccttcccggaccatgcatatgccggagctctagtgcaccgggttgcccttttt |
48598823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 65 - 229
Target Start/End: Complemental strand, 44363294 - 44363130
Alignment:
| Q |
65 |
actggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacca |
164 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||| |||||||| | ||||| |||| |||||||||||||||||| |||||| ||||| ||||| |
|
|
| T |
44363294 |
actggtaaagttgttgtcatgtgactgaaaggtcacgagttcaagtcctgaaaacagcctcgtgtgtaaaaaacagggtagggctgcgtacaacgcacca |
44363195 |
T |
 |
| Q |
165 |
ataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
| ||||||||||||||||||| ||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
44363194 |
aaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
44363130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 64 - 231
Target Start/End: Complemental strand, 47528691 - 47528528
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||| ||||||||| ||||||| |||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
47528691 |
aactggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacacc |
47528594 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|| |||||||||||||||||| ||||| | ||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
47528593 |
aa--atggtgggaccccttcccggaccctgaatatgtgggagctctagtgcaccgggttgcccttttt |
47528528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 64 - 231
Target Start/End: Original strand, 30639352 - 30639516
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||| ||| |||| |||||||| ||||||||| ||||||| |||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
30639352 |
aactggtaaagttgttgtcttgtgactgaaaggtcactggttcaagtcctggaaacagactcttgtgtaaaaa-cagggtaaggctgcgtacaatacacc |
30639450 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|| |||||| ||||||||||| ||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
30639451 |
aa--atggtgagaccccttcccggaccctgcatatgcgggagctttagtgcactgggttgcccttttt |
30639516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 114 - 231
Target Start/End: Complemental strand, 20639772 - 20639656
Alignment:
| Q |
114 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
213 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| ||||| || |||||||||||||||||| |
|
|
| T |
20639772 |
ggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaa-aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtg |
20639674 |
T |
 |
| Q |
214 |
caccgggttgcccttttt |
231 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
20639673 |
caccgggttgcccttttt |
20639656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 68 - 231
Target Start/End: Original strand, 35567146 - 35567307
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
167 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||||||||| ||||||| || |||||||||||||||||||||||||| ||||| |||||| | |
|
|
| T |
35567146 |
ggtaaagttgttgtcatgtaactgaaaggtcatgggttcaagtcttggaaacagccacttgtgtaaaaaacagggtaaggctgtgtacaacacacca--a |
35567243 |
T |
 |
| Q |
168 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|||||||||||||||||| |||| || | ||||||||||||||||||||||| |||||||||| |
|
|
| T |
35567244 |
atggtgggaccccttcccgaaccctgcgtctgcgggagctttagtgcaccgggctgcccttttt |
35567307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 86; E-Value: 6e-41
Query Start/End: Original strand, 64 - 231
Target Start/End: Complemental strand, 11054309 - 11054146
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||||| | ||||| ||||||||||||| ||||||||| |||| ||||||||||| |
|
|
| T |
11054309 |
aactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctgaaaacagtctcttgtgtaaaa--cagggtaagactgcgtacaatacacc |
11054212 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|| |||| || |||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11054211 |
aa--atggcggaaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttttt |
11054146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 86; E-Value: 6e-41
Query Start/End: Original strand, 67 - 219
Target Start/End: Original strand, 19027823 - 19027973
Alignment:
| Q |
67 |
tggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaat |
166 |
Q |
| |
|
||||| ||||||||||| || |||| |||||||||||||||||| ||||||||| |||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
19027823 |
tggtagagttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacaacatcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaat |
19027922 |
T |
 |
| Q |
167 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgg |
219 |
Q |
| |
|
|||||||||||||| |||||| | || |||| ||||||||||||||||||| |
|
|
| T |
19027923 |
--tggtgggacccctttccagactctgcgtatgtgggagctttagtgcaccgg |
19027973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 64 - 231
Target Start/End: Original strand, 10660376 - 10660543
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||| || |||||||| |||||||||||||| ||||||||| |||||| |||||||||||||||||| |
|
|
| T |
10660376 |
aactggtaaagttgttgtcatgtgactgaaaggttacatgttcaagtcctggaaacaacctcttatgtaaaaaatagggtatggctgcatacaatacacc |
10660475 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagcttt-agtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|||||||||| |||||||||| ||| || || |||||||||||||| |||||| |||||||||| |||| |
|
|
| T |
10660476 |
aataatggtgagaccccttccaaga-cctgcgtatgcgggagctttaagtgcatcgggttgcccctttt |
10660543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 64 - 231
Target Start/End: Original strand, 10874521 - 10874688
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||| || |||||||| |||||||||||||| ||||||||| |||||| |||||||||||||||||| |
|
|
| T |
10874521 |
aactggtaaagttgttgtcatgtgactgaaaggttacatgttcaagtcctggaaacaacctcttatgtaaaaaatagggtatggctgcatacaatacacc |
10874620 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagcttt-agtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|||||||||| |||||||||| ||| || || |||||||||||||| |||||| |||||||||| |||| |
|
|
| T |
10874621 |
aataatggtgagaccccttccaaga-cctgcgtatgcgggagctttaagtgcatcgggttgcccctttt |
10874688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 137 - 229
Target Start/End: Original strand, 20225119 - 20225211
Alignment:
| Q |
137 |
acagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20225119 |
acagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
20225211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 64 - 229
Target Start/End: Original strand, 20405065 - 20405224
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaa-aacagggtaaggctgcatacaatacac |
162 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| | |||||| |||||||||||||| ||||||||||| ||| |||||||||| |
|
|
| T |
20405065 |
aactggtaaagttgttgtcatgtgactggaaggtcacgggccta-------gaaacagcctcttgtgtaaaaaaacagggtaagattgcgtacaatacac |
20405157 |
T |
 |
| Q |
163 |
caataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
20405158 |
taataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcattgggttgcccttt |
20405224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 65 - 228
Target Start/End: Original strand, 40915802 - 40915962
Alignment:
| Q |
65 |
actggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacca |
164 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||||||||||| ||||||| |||||||||| ||||||| ||||||||||| |||||||||||| |
|
|
| T |
40915802 |
actggtaaagttgttgtcatgtgactataaggtcacgggttcaagtcctggaaacagcctcttgtgt-aaaaacaaggtaaggctgcgtacaatacacca |
40915900 |
T |
 |
| Q |
165 |
ataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctt |
228 |
Q |
| |
|
|||||||||| |||||||| ||||| || ||||||||||||| |||||||||| |||||||| |
|
|
| T |
40915901 |
--aatggtgggagcccttcccggaccctgcgtatgcgggagcttcagtgcaccggattgccctt |
40915962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 84; E-Value: 9e-40
Query Start/End: Original strand, 93 - 231
Target Start/End: Original strand, 47443958 - 47444094
Alignment:
| Q |
93 |
aaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagacccc |
192 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
47443958 |
aaggtcacgggttcaagtcctggaaacagcctcttgcgtaaaaaacagggtaaggctgcgtacaatacacca--aatggtgggaccccttcccggaccct |
47444055 |
T |
 |
| Q |
193 |
gcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|||||||| ||||||| ||||||| |||||||||||||| |
|
|
| T |
47444056 |
gcatatgcaggagcttcagtgcactgggttgcccttttt |
47444094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 83; E-Value: 4e-39
Query Start/End: Original strand, 72 - 232
Target Start/End: Original strand, 54175043 - 54175203
Alignment:
| Q |
72 |
aagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaa-caacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatg |
170 |
Q |
| |
|
||||||||||||||| |||| || ||||||| ||||||| ||||| || ||||||||||||||| |||||||||||||| ||||||||||||| |||| |
|
|
| T |
54175043 |
aagttgttgtcatgtgactgaaatgtcacggattcaagtcctggaaaacagcctcttgtgtaaaaa-cagggtaaggctgcgtacaatacaccaa-aatg |
54175140 |
T |
 |
| Q |
171 |
gtgggaccccttcccag-accccgcatatgcgggagctttagtgcaccgggttgcccttttta |
232 |
Q |
| |
|
||||||||||||||| | |||| |||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
54175141 |
gtgggaccccttccccggaccctgcatatgcgggagctttagtgcaccgggctgcccttttta |
54175203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 64 - 228
Target Start/End: Complemental strand, 8473783 - 8473621
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||| | || ||||||| ||||||||||| ||||||| |||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
8473783 |
aactggtaaagttgttgtcatatgaccggaaggttgcgggttcaagtcctggaaacagcctcttgtgtttaa--cagggtaaggctgcatacaatacacc |
8473686 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccag-acccc-gcatatgcgggagctttagtgcaccgggttgccctt |
228 |
Q |
| |
|
|| |||||||||||||||||| | ||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8473685 |
aa--atggtgggaccccttccccggacccctgcatatgcgggagctttagtgcaccgggttgccctt |
8473621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 72 - 231
Target Start/End: Complemental strand, 17043549 - 17043393
Alignment:
| Q |
72 |
aagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatgg |
171 |
Q |
| |
|
|||||||||||| || |||| |||||||| ||||||||| ||||||| |||||||||||||| ||||||||||||||| |||||||||||| ||||| |
|
|
| T |
17043549 |
aagttgttgtcaagtgactgaaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaatacagggtaaggctgcgtacaatacacca--aatgg |
17043452 |
T |
 |
| Q |
172 |
tgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||| |||||| || ||||| |||| |
|
|
| T |
17043451 |
tgggaccccttcccagaccctgcatatgctggagcttta-tgcaccaggctgcccctttt |
17043393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 64 - 231
Target Start/End: Complemental strand, 5306826 - 5306658
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
|||||||||||||| |||||||| |||| |||||||||||||||||| ||||||| |||||||||| |||| |||||||||| ||| ||||||||||| |
|
|
| T |
5306826 |
aactggtaaagttgatgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgt-aaaatcagggtaaggttgcgtacaatacacc |
5306728 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatg----cgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
| ||||||||||||||||||| ||||| || |||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
5306727 |
a--aatggtgggaccccttcccggaccctgcgtatgtggacgggagctttaatgcaccgggttgcccttttt |
5306658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 64 - 230
Target Start/End: Original strand, 14983806 - 14983970
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||| | | ||||||||||||| ||||||| |||||| |||||||||||||||| ||||||||| ||| |||||||||| |
|
|
| T |
14983806 |
aactggtaaagttgttgtcatatgattggaaggtcacggattcaagtctttgaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacact |
14983905 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
|| |||||||||||||||||| ||||| || |||||||||||||||||| ||| ||||||||||| |
|
|
| T |
14983906 |
aa--atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt |
14983970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 70 - 232
Target Start/End: Complemental strand, 9832468 - 9832310
Alignment:
| Q |
70 |
taaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataat |
169 |
Q |
| |
|
|||| ||||||| || | |||| |||||||||||||||||| | ||||| |||||||||||||| |||||||||||||| ||||||||||||| || |
|
|
| T |
9832468 |
taaaattgttgtgatctgactgaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--at |
9832373 |
T |
 |
| Q |
170 |
ggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttta |
232 |
Q |
| |
|
|||||||||||||||| ||||| |||||||| ||| || |||||||||||||||||||||||| |
|
|
| T |
9832372 |
ggtgggaccccttcccggaccctgcatatgcaggaactctagtgcaccgggttgcccttttta |
9832310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 64 - 215
Target Start/End: Original strand, 37494823 - 37494972
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||| |||| |||| |||||||| ||||||||| |||||||||||||||||||||||||||||||||| ||||||||||| ||| |
|
|
| T |
37494823 |
aactggtaaagttgttgccatgcgactgaaaggtcacaggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaaggttgcatacaatatacc |
37494922 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgca |
215 |
Q |
| |
|
| |||||||||||||||| | ||||| || ||||| |||||||||||||| |
|
|
| T |
37494923 |
a--aatggtgggacccctttcgggaccctgcgtatgcaggagctttagtgca |
37494972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 78 - 232
Target Start/End: Original strand, 25463108 - 25463259
Alignment:
| Q |
78 |
ttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggac |
177 |
Q |
| |
|
||||||||| |||| |||||||||||||||||| ||||||||||||||||||||||||| ||| |||| ||| ||||| |||||| ||||||||||| |
|
|
| T |
25463108 |
ttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaactgggaaaggttgcgtacaacacacca--aatggtgggac |
25463205 |
T |
 |
| Q |
178 |
cccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttta |
232 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||| ||||||| || | ||||||||| |
|
|
| T |
25463206 |
cccttcccggaccctgcatatgcgggagcttt-gtgcaccaggctacccttttta |
25463259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 114 - 232
Target Start/End: Original strand, 25629071 - 25629187
Alignment:
| Q |
114 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
213 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||| ||||||||||||| |||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
25629071 |
ggaaacagtctcttgtgtaaaaaatagggtaaggctgtgtacaatacaccaa--atggtgggaccccttcccggaccctacatatgcgggagctttagtg |
25629168 |
T |
 |
| Q |
214 |
caccgggttgcccttttta |
232 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
25629169 |
caccgggttgcccttttta |
25629187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 123 - 229
Target Start/End: Complemental strand, 48327869 - 48327763
Alignment:
| Q |
123 |
ctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggtt |
222 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| ||||| ||||||||| || |||||||||||||||| |
|
|
| T |
48327869 |
ctcttgtgtaaaaaacagggtaagactgcatacaatacaccaataatggtgggacctcttcccgaaccccacatatgcggaagttttagtgcaccgggtt |
48327770 |
T |
 |
| Q |
223 |
gcccttt |
229 |
Q |
| |
|
|||||| |
|
|
| T |
48327769 |
acccttt |
48327763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 88 - 227
Target Start/End: Complemental strand, 29208035 - 29207900
Alignment:
| Q |
88 |
actggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccag |
187 |
Q |
| |
|
|||| |||||||||||||||||| ||||| |||||||||||||| |||||||||||||| ||||||||||||| |||||||||||||||||| | |
|
|
| T |
29208035 |
actgaaaggtcacgggttcaagtcctggaaattgcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccgg |
29207940 |
T |
 |
| Q |
188 |
accccgcatatgcgggagctttagtgcaccgggttgccct |
227 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29207939 |
accctgcatatgcgggagctctagtgcaccgggttgccct |
29207900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 70 - 229
Target Start/End: Complemental strand, 30690340 - 30690176
Alignment:
| Q |
70 |
taaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaa-------cagggtaaggctgcatacaatacac |
162 |
Q |
| |
|
|||||| ||||||| || |||| |||||||||||||||||| ||||| | |||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30690340 |
taaagtggttgtcaagtgactgaaaggtcacgggttcaagtcctggaaaaagcctcttgtgtaaaaaataaaaaacagggtaaggctgcatacaatacac |
30690241 |
T |
 |
| Q |
163 |
caataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
|||| ||||||||||||||||| ||||| || |||||||||||||||||||||| || |||||||| |
|
|
| T |
30690240 |
caat--tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccaggctgcccttt |
30690176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 68 - 231
Target Start/End: Original strand, 54730225 - 54730389
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaac-agggtaaggctgcatacaatacaccaat |
166 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||| |||||| |||||||||||||||| ||| ||||||||| || ||||||||||| |
|
|
| T |
54730225 |
ggtaaagttgttgtcatgtgaccaaaaggtcacgggttcaagtcctagaaacagcctcttgtgtaaaaaaataggataaggctgcgtataatacaccaat |
54730324 |
T |
 |
| Q |
167 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|||| ||| |||||||||| ||||| || ||||||||||||||||||||||| || |||||||| |
|
|
| T |
54730325 |
aatgatggaaccccttcccggaccctgcgtatgcgggagctttagtgcaccgaattacccttttt |
54730389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 64 - 231
Target Start/End: Complemental strand, 30352754 - 30352578
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaa-----cagggtaag----gctgcata |
154 |
Q |
| |
|
|||||||||||||||||||| || || | ||||||||||||| ||| ||||||| |||||||||||||||| ||||||||| ||||| || |
|
|
| T |
30352754 |
aactggtaaagttgttgtcaagtgaccgaaaggtcacgggttagagtcctggaaacagcctcttgtgtaaaaaaaaaaacagggtaagtaaagctgcgta |
30352655 |
T |
 |
| Q |
155 |
caatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
||||||||||| ||||||||||||||||| | ||||| || ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
30352654 |
caatacaccaaaaatggtgggaccccttctcggaccctgcgtatgcgggagctttagtgcaccgtgttgcccttttt |
30352578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 68 - 226
Target Start/End: Original strand, 54966997 - 54967151
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
167 |
Q |
| |
|
||||||||||||||||||| |||| |||||||| |||||||| ||||| |||||||||||||||||||||||||||| ||| ||||||| |||| | |
|
|
| T |
54966997 |
ggtaaagttgttgtcatgtgactgaaaggtcacatgttcaagttctggaaagaacctcttgtgtaaaaaacagggtaaggttgc-tacaatatacca--a |
54967093 |
T |
 |
| Q |
168 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccc |
226 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||| |||||||||| ||||| |
|
|
| T |
54967094 |
atggtgggaccccttcccgtaccctacatatgcgggagcttt-gtgcaccgggctgccc |
54967151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 114 - 231
Target Start/End: Complemental strand, 9987947 - 9987832
Alignment:
| Q |
114 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
213 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||||| |||||||||||||||||| |||| |||||||||||||||||| || |
|
|
| T |
9987947 |
ggaaacaacctcttgtgtaaacaatagggtaaggctgcatacaatacacca--aatggtgggaccccttccttgaccttgcatatgcgggagctttaatg |
9987850 |
T |
 |
| Q |
214 |
caccgggttgcccttttt |
231 |
Q |
| |
|
||||||| |||| ||||| |
|
|
| T |
9987849 |
caccgggctgcctttttt |
9987832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 67 - 231
Target Start/End: Original strand, 25343162 - 25343326
Alignment:
| Q |
67 |
tggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaat |
166 |
Q |
| |
|
||||||||||||||||| || |||| ||||||| ||||||||| ||||| | ||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
25343162 |
tggtaaagttgttgtcacgtgactgataggtcacaggttcaagttctggaaatagtctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaa |
25343261 |
T |
 |
| Q |
167 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|| ||| ||||||||||| ||| || || |||| | ||||||||| ||||| || ||||| |||| |
|
|
| T |
25343262 |
aagggttggaccccttcctagatcctgcgtatgtgagagctttagagcacccggctgcccctttt |
25343326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 70 - 213
Target Start/End: Complemental strand, 30581624 - 30581481
Alignment:
| Q |
70 |
taaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaa-aaaacagggtaaggctgcatacaatacaccaataa |
168 |
Q |
| |
|
|||||||||||||| | ||| ||||||| |||||||||| |||||||||||||||||||| |||||||||||||| || ||||||||||||| || |
|
|
| T |
30581624 |
taaagttgttgtcacatcactaaaaggtcaagggttcaagtcgtggaaacaacctcttgtgtaaaaaaacagggtaagggtgtgtacaatacaccaa-aa |
30581526 |
T |
 |
| Q |
169 |
tggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
213 |
Q |
| |
|
||||||||||||||||| ||||| ||||||| |||||||||||| |
|
|
| T |
30581525 |
tggtgggaccccttcccggaccctgcatatgtaggagctttagtg |
30581481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 73 - 231
Target Start/End: Complemental strand, 39077948 - 39077794
Alignment:
| Q |
73 |
agttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggt |
172 |
Q |
| |
|
|||||||||||||| | || |||||||||||||||||| ||||||| |||||||||| |||||||||||||| ||| ||||||| |||| |||||| |
|
|
| T |
39077948 |
agttgttgtcatgtgattgaaaggtcacgggttcaagtcctggaaacagcctcttgtgt--aaaacagggtaaggttgcgtacaatatacca--aatggt |
39077853 |
T |
 |
| Q |
173 |
gggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
| ||| ||| || ||||| ||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
39077852 |
gagacatctttccggaccctgcatatgcgggagctctagtgcaccgggttgcctttttt |
39077794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 152 - 231
Target Start/End: Complemental strand, 33836564 - 33836485
Alignment:
| Q |
152 |
atacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| || |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33836564 |
atacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaacgggttgcccttttt |
33836485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 68 - 211
Target Start/End: Complemental strand, 39029220 - 39029078
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
167 |
Q |
| |
|
||||||||||||||| ||| ||| ||||||| |||||||| ||||||| ||||||||||||||||||||||||||||| |||||||||| || | |
|
|
| T |
39029220 |
ggtaaagttgttgtcgtgtgactaaaaggtcataggttcaagccttggaaacagcctcttgtgtaaaaaacagggtaaggctgtgtacaatacacgaa-a |
39029122 |
T |
 |
| Q |
168 |
atggtgggaccccttcccagaccccgcatatgcgggagctttag |
211 |
Q |
| |
|
||||||||||| ||| || ||||| ||||||||||||||||||| |
|
|
| T |
39029121 |
atggtgggaccactttccggaccctgcatatgcgggagctttag |
39029078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 116 - 230
Target Start/End: Complemental strand, 51865149 - 51865037
Alignment:
| Q |
116 |
aaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgca |
215 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||| |||||||||||| ||||||||| ||||||||| ||||| || ||||||||||||||| |||| |
|
|
| T |
51865149 |
aaacagcctcttgtgtaaaaaacatggtaaggctgcgtacaatacacca--aatggtggggccccttcccggaccctgcgtatgcgggagctttattgca |
51865052 |
T |
 |
| Q |
216 |
ccgggttgccctttt |
230 |
Q |
| |
|
|||| ||||||||| |
|
|
| T |
51865051 |
ccggactgccctttt |
51865037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 68 - 220
Target Start/End: Complemental strand, 487294 - 487135
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
167 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||||||| ||||||||||||||||||| |||||| ||||| ||||| |||||||||| || | |
|
|
| T |
487294 |
ggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcttggaaacaacctcttgtgtataaaacaaggtaaagctgcgtacaatacactaaaa |
487195 |
T |
 |
| Q |
168 |
-------atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
220 |
Q |
| |
|
|||| ||||||||||||| || | || |||||||||||||||||||||||| |
|
|
| T |
487194 |
tggtgggatggcgggaccccttcccggattctgcgaatgcgggagctttagtgcaccggg |
487135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 71 - 211
Target Start/End: Complemental strand, 49938746 - 49938611
Alignment:
| Q |
71 |
aaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatg |
170 |
Q |
| |
|
||||||||||||| || |||| |||||||| ||||||||| ||||||| ||||||||||||||| | |||||||| || ||||||||||||| |||| |
|
|
| T |
49938746 |
aaagttgttgtcacgtgactgaaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaaa-cggggtaagg-tg--tacaatacaccaa-aatg |
49938652 |
T |
 |
| Q |
171 |
gtgggaccccttcccagaccccgcatatgcgggagctttag |
211 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
49938651 |
gtgggaccccttcccataccctgcatatgcgggagctttag |
49938611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 68 - 231
Target Start/End: Complemental strand, 20908797 - 20908634
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaag-gtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaat |
166 |
Q |
| |
|
||||||||||||||||||| |||| || || || |||||||| | ||||||| | |||| | ||||||| | ||||||||||| ||||||||||||| |
|
|
| T |
20908797 |
ggtaaagttgttgtcatgtgactgaaaatgttacatgttcaagtcatggaaacatcgtcttttctaaaaaagaaggtaaggctgcgtacaatacaccaa- |
20908699 |
T |
 |
| Q |
167 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
||||||||||||||||||| |||| || ||||||||||||||||||||| || |||||||||| |
|
|
| T |
20908698 |
aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcacaaggctgcccttttt |
20908634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 70 - 229
Target Start/End: Complemental strand, 32478942 - 32478792
Alignment:
| Q |
70 |
taaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataat |
169 |
Q |
| |
|
||||||||||||||||| || | ||||||| ||||||||| ||||||||||||| ||||||||| ||||||||||||| |||||||||| || |
|
|
| T |
32478942 |
taaagttgttgtcatgtgaccgagaggtcacaggttcaagtcctggaaacaacctctagtgtaaaaa-cagggtaaggctg-----aatacaccaa--at |
32478851 |
T |
 |
| Q |
170 |
ggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
|||||||||||||||| ||||| || |||||||||||||| ||||||||||| ||||||| |
|
|
| T |
32478850 |
ggtgggaccccttcccggacccagcgtatgcgggagcttt-gtgcaccgggtggcccttt |
32478792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 71 - 218
Target Start/End: Complemental strand, 30496476 - 30496333
Alignment:
| Q |
71 |
aaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatg |
170 |
Q |
| |
|
||||||||||||| || |||| ||||||||| |||||||| | ||||||| ||||||||||||| | ||||||||||||||||||||||||| |||| |
|
|
| T |
30496476 |
aaagttgttgtcacgtgactgaaaggtcacgtgttcaagtcatggaaacagcctcttgtgtaaaca--cgggtaaggctgcatacaatacacca--aatg |
30496381 |
T |
 |
| Q |
171 |
gtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
218 |
Q |
| |
|
| ||||| ||||||| |||| || |||| ||||||||||||||||| |
|
|
| T |
30496380 |
gggggactccttcccggaccgtgcttatgatggagctttagtgcaccg |
30496333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 64 - 178
Target Start/End: Original strand, 14590809 - 14590922
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgt-aaaaaacagggtaaggctgcatacaatacac |
162 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||| ||||||| |||||| |||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
14590809 |
aactggtaaagttgttgtcatgtgactgaaaggtcacggattcaagtcctagaaacagcctcttgtctaaaaaaacagggtaaggctgcatacaatacat |
14590908 |
T |
 |
| Q |
163 |
caataatggtgggacc |
178 |
Q |
| |
|
|| |||||||||||| |
|
|
| T |
14590909 |
ca--aatggtgggacc |
14590922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 168 - 231
Target Start/End: Original strand, 32484307 - 32484370
Alignment:
| Q |
168 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32484307 |
atggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
32484370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 64 - 229
Target Start/End: Complemental strand, 55766629 - 55766466
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcac-gggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacac |
162 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||| |||||||||| ||||||| |||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
55766629 |
aactggtaaagttgttgtcatgtgaccggaaggtcacggggttcaagttttggaaacagtttcttgtgt-gtaaacagggtaaggctgcgtacaatacac |
55766531 |
T |
 |
| Q |
163 |
caataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
|||||||| ||||| |||| |||| || |||||| |||||||||||||||||| |||||||| |
|
|
| T |
55766530 |
--tgaatggtggaaccccatcccggaccttgcgtatgcgagagctttagtgcaccgggatgcccttt |
55766466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 134 - 220
Target Start/End: Original strand, 16494259 - 16494345
Alignment:
| Q |
134 |
aaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
220 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||||||||||||| ||||||||||| | ||||||| |||||||||| |||||| |
|
|
| T |
16494259 |
aaaacagggtaaagctgcatacaatacaccaaaaatggtgggaccctttcccagaccctgtgtatgcggaagctttagtgtaccggg |
16494345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 114 - 224
Target Start/End: Original strand, 21489109 - 21489218
Alignment:
| Q |
114 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
213 |
Q |
| |
|
||||||| ||||||| ||||||||||| ||||| |||| |||||| |||||| ||||||||||||||||||| |||| || |||||||||||||| ||| |
|
|
| T |
21489109 |
ggaaacagcctcttgcgtaaaaaacagagtaagactgcgtacaatgcaccaa-aatggtgggaccccttcccgaaccctgcgtatgcgggagctttcgtg |
21489207 |
T |
 |
| Q |
214 |
caccgggttgc |
224 |
Q |
| |
|
||| ||||||| |
|
|
| T |
21489208 |
cactgggttgc |
21489218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 75 - 216
Target Start/End: Complemental strand, 41018945 - 41018807
Alignment:
| Q |
75 |
ttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgg |
174 |
Q |
| |
|
||||||||| || |||| |||||||||||||||||| |||||||||||||||||| |||| ||||||||||| | |||||||||||| ||| |||| |
|
|
| T |
41018945 |
ttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgt-aaaattagggtaaggctacgtacaatacacca--aatagtgg |
41018849 |
T |
 |
| Q |
175 |
gaccccttcccagaccccgcatatgcgggagctttagtgcac |
216 |
Q |
| |
|
|||||||||||||||| || |||| || |||||||||||| |
|
|
| T |
41018848 |
gaccccttcccagaccttgcgtatggaggggctttagtgcac |
41018807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 164 - 229
Target Start/End: Complemental strand, 38755973 - 38755908
Alignment:
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
|||||||||||||||||||||| ||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
38755973 |
aataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
38755908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 114 - 228
Target Start/End: Complemental strand, 7909393 - 7909281
Alignment:
| Q |
114 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgc-gggagctttagt |
212 |
Q |
| |
|
||||||| |||||||||||||| |||||||||| ||| |||||||||||| ||||||||||||||||||| |||| || ||||| |||||||||||| |
|
|
| T |
7909393 |
ggaaacagtctcttgtgtaaaaa-cagggtaaggttgcgtacaatacacca--aatggtgggaccccttcccgaaccctgcgtatgcggggagctttagt |
7909297 |
T |
 |
| Q |
213 |
gcaccgggttgccctt |
228 |
Q |
| |
|
||| |||||||||||| |
|
|
| T |
7909296 |
gcatcgggttgccctt |
7909281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 167 - 231
Target Start/End: Original strand, 38786682 - 38786746
Alignment:
| Q |
167 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38786682 |
aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttttt |
38786746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 68 - 152
Target Start/End: Original strand, 43035224 - 43035308
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgca |
152 |
Q |
| |
|
|||||||||||||||| || |||| |||||||||||||||||| |||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
43035224 |
ggtaaagttgttgtcacgtgactgaaaggtcacgggttcaagtccaggaaacaacctcttgtgtaagaaacacggtaaggctgca |
43035308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 68 - 151
Target Start/End: Complemental strand, 42164307 - 42164225
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgc |
151 |
Q |
| |
|
|||||| |||||||||||| |||| |||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
42164307 |
ggtaaaattgttgtcatgtgactgaaaggtcacgggttcaagtcttggaaacaacctcttgtgta-aaaacagggtaaggctgc |
42164225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 75 - 206
Target Start/End: Complemental strand, 7385628 - 7385499
Alignment:
| Q |
75 |
ttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgg |
174 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||| ||||||| |||| ||||||||||| ||||||||| || | |||||||||| |||||||| |
|
|
| T |
7385628 |
ttgttgtcatgtgactgaaaggtcacgggttcaagccctggaaacagcctcatgtgtaaaaaatagggtaaggttgtgtgcaatacacca--aatggtgg |
7385531 |
T |
 |
| Q |
175 |
gaccccttcccagaccccgcatatgcgggagc |
206 |
Q |
| |
|
||||| ||||| ||||| | ||||||||||| |
|
|
| T |
7385530 |
gaccctttcccggaccctgtgtatgcgggagc |
7385499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 129 - 232
Target Start/End: Complemental strand, 10277855 - 10277754
Alignment:
| Q |
129 |
tgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctt |
228 |
Q |
| |
|
|||| |||| ||| ||||||||| ||||||||||||| |||||| |||||||||||||||| ||||||||||||| | ||||| ||||| |||||||| |
|
|
| T |
10277855 |
tgtataaaataggataaggctgcgtacaatacaccaa--atggtgaaaccccttcccagaccctgcatatgcgggagttctagtgaaccggattgccctt |
10277758 |
T |
 |
| Q |
229 |
ttta |
232 |
Q |
| |
|
|||| |
|
|
| T |
10277757 |
ttta |
10277754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 68 - 191
Target Start/End: Complemental strand, 47441689 - 47441568
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
167 |
Q |
| |
|
|||||||||||||||| || |||| |||||||| ||||||||| |||||| ||||| |||||||| ||||||||||||| |||||||||||| | |
|
|
| T |
47441689 |
ggtaaagttgttgtcacgtgactgaaaggtcacaggttcaagtccaagaaacagtctcttttgtaaaaatcagggtaaggctgtgtacaatacacca--a |
47441592 |
T |
 |
| Q |
168 |
atggtgggaccccttcccagaccc |
191 |
Q |
| |
|
||||| |||||||||||| ||||| |
|
|
| T |
47441591 |
atggttggaccccttcccggaccc |
47441568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 64 - 229
Target Start/End: Complemental strand, 55830884 - 55830721
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgg-gttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacac |
162 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||| |||||||| ||||||| ||||||||| ||| |||||||| ||||| |||||||||| |
|
|
| T |
55830884 |
aactggtaaagttgttgtcatgtgatcggaaggtcacggagttcaagttttggaaacagtctcttgtgtgtaaa-cagggtaatgctgcgtacaatacac |
55830786 |
T |
 |
| Q |
163 |
caataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
| ||||||| ||||| |||| |||| || |||||| ||||||||||||||| || |||||||| |
|
|
| T |
55830785 |
tga--atggtggaaccccatcccggaccttgcgtatgcgagagctttagtgcaccaggatgcccttt |
55830721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 80 - 230
Target Start/End: Original strand, 7038041 - 7038188
Alignment:
| Q |
80 |
gtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccc |
179 |
Q |
| |
|
||||||| |||| |||||||| ||||||||| | ||||| | |||||||||||||| |||||||| || | ||||||||||||| ||||||||| | | |
|
|
| T |
7038041 |
gtcatgtgactgaaaggtcacaggttcaagtcctg-aaacagcttcttgtgtaaaaaatagggtaagacttcgtacaatacaccaa-aatggtggggcac |
7038138 |
T |
 |
| Q |
180 |
cttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
|| ||| ||||| || ||| | ||||||||||||||| ||||||||||||| |
|
|
| T |
7038139 |
ctacccggaccctgcgtatac-ggagctttagtgcactgggttgccctttt |
7038188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 167 - 229
Target Start/End: Original strand, 11394925 - 11394987
Alignment:
| Q |
167 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
|||||||||||||||| || ||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
11394925 |
aatggtgggacccctttccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
11394987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 167 - 229
Target Start/End: Original strand, 11404652 - 11404714
Alignment:
| Q |
167 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
|||||||||||||||| || ||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
11404652 |
aatggtgggacccctttccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
11404714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 68 - 154
Target Start/End: Complemental strand, 17315457 - 17315372
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcata |
154 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||||| | ||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
17315457 |
ggtaaagttgttgtcatgtgactgaaaggtcacgggttcaattcctcgaaacaacctcttgtgt-aaaaacaaggtaaggctgcata |
17315372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 133 - 231
Target Start/End: Complemental strand, 36816479 - 36816382
Alignment:
| Q |
133 |
aaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|||||||||| | |||||| ||||||||||||| || |||||||| |||||| ||||| | |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
36816479 |
aaaaacagggcagggctgcgtacaatacaccaaaaa-ggtgggactccttcctggaccctgtgtatgcgggagctttagtgtaccgggttgcccttttt |
36816382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 56322984 - 56323038
Alignment:
| Q |
178 |
cccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttta |
232 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56322984 |
cccttcccggaccccggatatgcgggagctttagtgcaccgggttgcccttttta |
56323038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 70 - 231
Target Start/End: Complemental strand, 23580365 - 23580206
Alignment:
| Q |
70 |
taaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataat |
169 |
Q |
| |
|
|||||||||||||| || |||| |||||||||||||||||| |||| | ||||||||||||||||||||| ||| |||| || ||||||||| ||| |
|
|
| T |
23580365 |
taaagttgttgtcacgtgactgaaaggtcacgggttcaagttctagaaagagcctcttgtgtaaaaaacaggggaagactgcgtaggatacaccaa-aat |
23580267 |
T |
 |
| Q |
170 |
ggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|| | ||||||||| || || | |||| |||||||||||||||||| | |||||||||| |
|
|
| T |
23580266 |
ggcgagaccccttcttgga-cctgtgtatgtgggagctttagtgcaccgagctgcccttttt |
23580206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 168 - 229
Target Start/End: Complemental strand, 40553998 - 40553937
Alignment:
| Q |
168 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
|||||| ||||||||||| ||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
40553998 |
atggtgtgaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
40553937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 168 - 229
Target Start/End: Original strand, 44718641 - 44718702
Alignment:
| Q |
168 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||||||| |||||||||||||||| |
|
|
| T |
44718641 |
atggtgggaccccttcccagaccctgcgtatgcgggagctttagcacaccgggttgcccttt |
44718702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 69 - 209
Target Start/End: Complemental strand, 3580994 - 3580860
Alignment:
| Q |
69 |
gtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataa |
168 |
Q |
| |
|
|||||||||||||||||| |||| || |||||| |||||||| || || ||||||||||||||| || |||||||||| | |||||||||| || |
|
|
| T |
3580994 |
gtaaagttgttgtcatgtgactgaaaagtcacgagttcaagtctggaaa----cctcttgtgtaaaaaccatggtaaggctgtgtgcaatacacca--aa |
3580901 |
T |
 |
| Q |
169 |
tggtgggaccccttcccagaccccgcatatgcgggagcttt |
209 |
Q |
| |
|
|| | |||||||||||| ||||| ||||||| ||||||||| |
|
|
| T |
3580900 |
tgctaggaccccttcccggaccctgcatatgtgggagcttt |
3580860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 167 - 231
Target Start/End: Original strand, 28494224 - 28494288
Alignment:
| Q |
167 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||| |||||||||||| |||| ||||| |
|
|
| T |
28494224 |
aatggtgggaccccttcccagatcctgcatatgcgggagctctagtgcaccgggctgcctttttt |
28494288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 114 - 208
Target Start/End: Original strand, 49796820 - 49796911
Alignment:
| Q |
114 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctt |
208 |
Q |
| |
|
||||||| |||||||||| |||| || ||||||||||| ||||||||||||| |||||||||||||||||| |||| || ||||||||||||| |
|
|
| T |
49796820 |
ggaaacagcctcttgtgttaaaa-catggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccgaaccctgcgtatgcgggagctt |
49796911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 136 - 229
Target Start/End: Original strand, 2813169 - 2813263
Alignment:
| Q |
136 |
aacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagcttt-agtgcaccgggttgcccttt |
229 |
Q |
| |
|
||||||||||| |||| ||||||||| ||||||||||||||||| ||||| || || |||||||||||||| |||||||||| ||||||||| |
|
|
| T |
2813169 |
aacagggtaagactgcgtacaatacatcaataatggtgggaccctttcccgaacgatgcgtatgcgggagctttaagtgcaccggattgcccttt |
2813263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 116 - 228
Target Start/End: Complemental strand, 12711561 - 12711450
Alignment:
| Q |
116 |
aaacaacctcttgtgtaaaaaac-agggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgc |
214 |
Q |
| |
|
||||||| |||||||||||||| |||||||| |||| ||||||||||||| |||| ||||||||||| |||||| || ||||||| | ||||||||| |
|
|
| T |
12711561 |
aaacaacatcttgtgtaaaaaaatagggtaagactgcgtacaatacaccaa--atggcgggaccccttctcagacctagcgtatgcggaaactttagtgc |
12711464 |
T |
 |
| Q |
215 |
accgggttgccctt |
228 |
Q |
| |
|
||| ||||||||| |
|
|
| T |
12711463 |
acccagttgccctt |
12711450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 169 - 231
Target Start/End: Original strand, 19027986 - 19028048
Alignment:
| Q |
169 |
tggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
||||||||| ||||||| |||||| | ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
19027986 |
tggtgggactccttcccggaccccacttatgcgggagctttagtgcaccgggctgcccttttt |
19028048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 167 - 229
Target Start/End: Original strand, 25388249 - 25388311
Alignment:
| Q |
167 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
||||||||||||||||||| ||||| || ||||| ||||||||||||||||||||||||||| |
|
|
| T |
25388249 |
aatggtgggaccccttcccggaccctgcgtatgcatgagctttagtgcaccgggttgcccttt |
25388311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 72 - 164
Target Start/End: Original strand, 51420553 - 51420646
Alignment:
| Q |
72 |
aagttgttgtcatgtaactggaaggtcacggg-ttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacca |
164 |
Q |
| |
|
|||||||||||| || |||| ||||||| | ||||||| | ||||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
51420553 |
aagttgttgtcacgtgactgaaaggtcagttgattcaagtcatggaaacaacctcttgtgtagaaaacagggtaaggctgggtacaatacacca |
51420646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 179 - 231
Target Start/End: Original strand, 35532077 - 35532129
Alignment:
| Q |
179 |
ccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
||||||| ||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
35532077 |
ccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttttt |
35532129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 114 - 226
Target Start/End: Original strand, 36589765 - 36589876
Alignment:
| Q |
114 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
213 |
Q |
| |
|
||||||| |||||||||||||||||| ||||| |||| ||| |||||||| |||||||||||||||||| |||| |||||||||||||| ||| |
|
|
| T |
36589765 |
ggaaacagcctcttgtgtaaaaaacatggtaatgctgttgacagtacaccaa-aatggtgggaccccttcctgaaccctatgtatgcgggagctttggtg |
36589863 |
T |
 |
| Q |
214 |
caccgggttgccc |
226 |
Q |
| |
|
||||||| ||||| |
|
|
| T |
36589864 |
caccgggctgccc |
36589876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 67 - 191
Target Start/End: Original strand, 44357195 - 44357318
Alignment:
| Q |
67 |
tggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaat |
166 |
Q |
| |
|
|||||||||| |||| ||||||||| ||||||| | |||||||| |||||||||| |||||||| ||| || ||||| | | ||||||||||||| |
|
|
| T |
44357195 |
tggtaaagttattgttatgtaactgaaaggtcatgagttcaagtcctagaaacaaccttttgtgtaataaatagagtaagacgacgtacaatacaccaa- |
44357293 |
T |
 |
| Q |
167 |
aatggtgggaccccttcccagaccc |
191 |
Q |
| |
|
||||| |||||| |||||||||||| |
|
|
| T |
44357294 |
aatggcgggacctcttcccagaccc |
44357318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 164 - 231
Target Start/End: Complemental strand, 50555721 - 50555654
Alignment:
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
||||||||||| |||||||||| ||||| || ||||| |||| |||||||||||||| |||||||||| |
|
|
| T |
50555721 |
aataatggtggaaccccttcccggaccctgcgtatgcaggagttttagtgcaccgggctgcccttttt |
50555654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 161 - 230
Target Start/End: Complemental strand, 47482918 - 47482849
Alignment:
| Q |
161 |
accaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
||||| ||||||||||||||||||| ||||| || |||||||||||||| ||||| || | ||||||||| |
|
|
| T |
47482918 |
accaaaaatggtgggaccccttcccggaccctgcgtatgcgggagctttggtgcaacgagctgccctttt |
47482849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 101 - 184
Target Start/End: Complemental strand, 17079777 - 17079696
Alignment:
| Q |
101 |
gggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcc |
184 |
Q |
| |
|
|||||||||| |||||||| ||||||||| ||||||||||||||||||||||||||| | | ||||||||||||| |||| |
|
|
| T |
17079777 |
gggttcaagtcttggaaacaatatcttgtgtataaaacagggtaaggctgcatacaatacgcta--aatggtgggaccctttcc |
17079696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 77 - 213
Target Start/End: Complemental strand, 32629418 - 32629285
Alignment:
| Q |
77 |
gttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtggga |
176 |
Q |
| |
|
|||||||||| |||| |||||||||||||||| | |||||| |||||||| ||||||||||||||||| || ||| ||||||||| | ||| |||| |
|
|
| T |
32629418 |
gttgtcatgtgactgaaaggtcacgggttcaaatcctcgaaacagcctcttgt-aaaaaaacagggtaaggccgcctac-atacaccaa-attggcggga |
32629322 |
T |
 |
| Q |
177 |
ccccttcccagaccccgcatatgcgggagctttagtg |
213 |
Q |
| |
|
||||||||| |||| || |||| ||||| ||||||| |
|
|
| T |
32629321 |
ccccttcccggaccttgcgtatgtgggagttttagtg |
32629285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 164 - 215
Target Start/End: Original strand, 8820578 - 8820629
Alignment:
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgca |
215 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||| ||| ||||||||| |
|
|
| T |
8820578 |
aataatggtgggaccccttcccagaccctgcgtatgcgagagttttagtgca |
8820629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 126 - 185
Target Start/End: Complemental strand, 35894563 - 35894505
Alignment:
| Q |
126 |
ttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttccc |
185 |
Q |
| |
|
|||||||||||||| |||||| ||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
35894563 |
ttgtgtaaaaaacacggtaagtgtgcgtacaatacaccaa-aatggtgggaccccttccc |
35894505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 62 - 108
Target Start/End: Complemental strand, 5313159 - 5313113
Alignment:
| Q |
62 |
gtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaa |
108 |
Q |
| |
|
||||||||||||||||||||||||| | || |||||||||||||||| |
|
|
| T |
5313159 |
gtaactggtaaagttgttgtcatgtgattgaaaggtcacgggttcaa |
5313113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 68 - 137
Target Start/End: Complemental strand, 54640498 - 54640429
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaa |
137 |
Q |
| |
|
|||||| ||||||||| || ||| |||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
54640498 |
ggtaaaattgttgtcacgtggctgaaaggtcacgggttcaagtcttggaaacagcctcttgtgtaaaaaa |
54640429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 168 - 228
Target Start/End: Original strand, 21003410 - 21003469
Alignment:
| Q |
168 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctt |
228 |
Q |
| |
|
|||||| |||| |||||||||||| || | |||||||||||| |||||||||| ||||||| |
|
|
| T |
21003410 |
atggtgtgacctcttcccagaccctgcgtgtgcgggagcttt-gtgcaccgggctgccctt |
21003469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 177 - 229
Target Start/End: Complemental strand, 34257034 - 34256982
Alignment:
| Q |
177 |
ccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
||||||| |||||| ||| |||||||||||||||||||||||| ||| |||| |
|
|
| T |
34257034 |
ccccttctcagaccttgcacatgcgggagctttagtgcaccgggctgctcttt |
34256982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 131; Significance: 8e-68; HSPs: 70)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 131; E-Value: 8e-68
Query Start/End: Original strand, 64 - 230
Target Start/End: Complemental strand, 4619269 - 4619103
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| ||||| | |||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4619269 |
aactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaatagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacacc |
4619170 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4619169 |
aataatggtgggaccccttcccggaccccgcatatgcgagagctttagtgcaccgggttgccctttt |
4619103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 123; E-Value: 5e-63
Query Start/End: Original strand, 64 - 230
Target Start/End: Original strand, 38879553 - 38879719
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||||| ||||||| |||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
38879553 |
aactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaacagggtaaggctgcgtacaatacacc |
38879652 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
|||||||||||||||||||||| ||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
38879653 |
aataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
38879719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 116; E-Value: 7e-59
Query Start/End: Original strand, 64 - 230
Target Start/End: Original strand, 41014291 - 41014454
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| ||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
41014291 |
aactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaa-cagggtaaggctgcgtacaatacacc |
41014389 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
|| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41014390 |
aa--atggtgggaccccttcctggaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
41014454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 64 - 231
Target Start/End: Original strand, 24448862 - 24449027
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| ||| |||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
24448862 |
aactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagccttttgtgtaaaaaatagggtaaggctgcgtacaatacacc |
24448961 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
| ||||||||||||||||||| ||||| || ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
24448962 |
a--aatggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcaccgggttgcccttttt |
24449027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 106; E-Value: 7e-53
Query Start/End: Original strand, 64 - 232
Target Start/End: Original strand, 43334174 - 43334342
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaa-aacagggtaaggctgcatacaatacac |
162 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||||| ||||||| |||| ||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
43334174 |
aactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcctgtgtaaaaaaacagggtaaggctgcgtacaatacac |
43334273 |
T |
 |
| Q |
163 |
caataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttta |
232 |
Q |
| |
|
||| ||||||||||||||||||| ||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
43334274 |
caaaaatggtgggaccccttcccggaccctgc-gatgcgggagctttagtgcaccgggttgcccttttta |
43334342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 72 - 228
Target Start/End: Complemental strand, 12006485 - 12006329
Alignment:
| Q |
72 |
aagttgttgtcatgtaactggaaggtcacggg-ttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatg |
170 |
Q |
| |
|
||||||||||||||| |||| ||||||||||| ||||||| || |||||||||||| ||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
12006485 |
aagttgttgtcatgtgactgaaaggtcacggggttcaagtctgg-aaacaacctcttatgtaaaaaatagggtaaggctccatacaatacaccaataatg |
12006387 |
T |
 |
| Q |
171 |
gtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctt |
228 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||||||||||| ||||||||| |
|
|
| T |
12006386 |
gtgggaccccttcccagaccctgcctatgcgggagctttagtgcaccgtgttgccctt |
12006329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 101 - 229
Target Start/End: Complemental strand, 13801895 - 13801767
Alignment:
| Q |
101 |
gggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgc |
200 |
Q |
| |
|
|||||||||| |||| || |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13801895 |
gggttcaagtcctggaagcagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgc |
13801796 |
T |
 |
| Q |
201 |
gggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
| ||||||||||||||||||||||||||| |
|
|
| T |
13801795 |
gagagctttagtgcaccgggttgcccttt |
13801767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 67 - 230
Target Start/End: Original strand, 27328727 - 27328890
Alignment:
| Q |
67 |
tggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaat |
166 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||| ||||||||| ||||||| ||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
27328727 |
tggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagtctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaat |
27328826 |
T |
 |
| Q |
167 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
||||||||||||||||||| |||| || ||||||||||||||| |||| ||| ||||| |||| |
|
|
| T |
27328827 |
aatggtgggaccccttcccgaaccctgcgtatgcgggagctttaatgcatcggattgccttttt |
27328890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 64 - 232
Target Start/End: Complemental strand, 8170145 - 8169981
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| || | |||||||||||||||||| ||||||| ||| |||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
8170145 |
aactggtaaagttgttgtcatgtgaccgaaaggtcacgggttcaagtcctggaaacagccttttgtgtaaaa--cagggtaaggctgcgtacaatacacc |
8170048 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttta |
232 |
Q |
| |
|
|| |||||||||||||||||| ||||| ||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
8170047 |
aa--atggtgggaccccttcccggaccctgcatatgcgggagtttcagtgcaccgggttgcccttttta |
8169981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 64 - 231
Target Start/End: Original strand, 35710285 - 35710448
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||| ||||||| |||||||||| |||| ||||||||||||| | ||||||||| |
|
|
| T |
35710285 |
aactggtaaagttgttgtcatgtaactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgt--aaaatagggtaaggctgcgttcaatacacc |
35710382 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
| ||||||||||||||||||| || | ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35710383 |
a--aatggtgggaccccttcccggaacatgcatatgcgggagctctagtgcaccgggttgcccttttt |
35710448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 91; E-Value: 6e-44
Query Start/End: Original strand, 114 - 228
Target Start/End: Original strand, 20135626 - 20135740
Alignment:
| Q |
114 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
213 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| ||||||| |||| |
|
|
| T |
20135626 |
ggaaacagcctcttgtgtaaaaaacaaggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcaggagcttcagtg |
20135725 |
T |
 |
| Q |
214 |
caccgggttgccctt |
228 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
20135726 |
caccgggttgccctt |
20135740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 79 - 230
Target Start/End: Original strand, 32703411 - 32703558
Alignment:
| Q |
79 |
tgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggacc |
178 |
Q |
| |
|
|||||||| |||| |||||||||||||||||| ||||||| |||||||||||||| |||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
32703411 |
tgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggacc |
32703506 |
T |
 |
| Q |
179 |
ccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32703507 |
ccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
32703558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 79; E-Value: 9e-37
Query Start/End: Original strand, 68 - 230
Target Start/End: Complemental strand, 28516593 - 28516432
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
167 |
Q |
| |
|
|||||||||||||||| || ||| |||||||||||||||||| ||||||| |||||||||||||||||||| || |||||| ||||||||| ||| | |
|
|
| T |
28516593 |
ggtaaagttgttgtcaggtggctgaaaggtcacgggttcaagtcttggaaacatcctcttgtgtaaaaaacaggctagggctgcgtacaatacatcaa-a |
28516495 |
T |
 |
| Q |
168 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
|||||||||||| ||||||||||| || |||| |||||||||||| ||| |||||||||||| |
|
|
| T |
28516494 |
atggtgggacccattcccagaccctgcgcatgcaggagctttagtggaccaggttgccctttt |
28516432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 64 - 229
Target Start/End: Original strand, 1565403 - 1565566
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgt-aaaaaacagggtaaggctgcatacaatacac |
162 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||| ||||||||||| ||||||||||||||| || |||||||| ||||||||| |||||| ||| |
|
|
| T |
1565403 |
aactggtaaagttgttgtcatgtgactgaaaggtcgcgggttcaagtcctggaaacaacctcttgagtaaaaaaacatattaaggctgcgtacaatgcac |
1565502 |
T |
 |
| Q |
163 |
caataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
|| ||||| ||||||||||||| ||||| ||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
1565503 |
ca--aatggcgggaccccttcccggaccctgcatatgtgggagc-ttagtgcaccgggttgcccttt |
1565566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 68 - 220
Target Start/End: Complemental strand, 209086 - 208936
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
167 |
Q |
| |
|
||||||||||||||||||| ||| |||||||| |||||||| || |||||||||||||||| |||||||||||||||||||| ||||||||||| | |
|
|
| T |
209086 |
ggtaaagttgttgtcatgtgactaaaaggtcacaagttcaagtcctggcaacaacctcttgtgta-aaaacagggtaaggctgcattcaatacaccaa-a |
208989 |
T |
 |
| Q |
168 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
220 |
Q |
| |
|
||||||||||||||||| ||||| | ||||| |||||||||||||||||| |
|
|
| T |
208988 |
atggtgggaccccttcctggaccctgggtatgcaagagctttagtgcaccggg |
208936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 62 - 209
Target Start/End: Original strand, 22600424 - 22600569
Alignment:
| Q |
62 |
gtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaataca |
161 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||| |||||||||||| |||||||| | |||||||||| |||||||||||||| ||||||||| |
|
|
| T |
22600424 |
gtaactggtaaagttgttatcatgtgactggaaggttacgggttcaagtcctggaaacaatattttgtgtaaaacacagggtaaggctgtgtacaataca |
22600523 |
T |
 |
| Q |
162 |
ccaataatggtgggaccccttcccagaccccgcatatgcgggagcttt |
209 |
Q |
| |
|
||| |||||||||| |||||||| || || || |||||||||||||| |
|
|
| T |
22600524 |
cca--aatggtgggatcccttcccggatcctgcgtatgcgggagcttt |
22600569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 68 - 220
Target Start/End: Original strand, 39301099 - 39301249
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
167 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||||||| || |||||||||||||||| |||||||||||||| ||| || ||| |||||| | |
|
|
| T |
39301099 |
ggtaaagttgttgtcatgttactgaaaggtcacgggttcaagtcttgggaacaacctcttgtgtataaaacagggtaaggatgcgtataatgcaccaa-a |
39301197 |
T |
 |
| Q |
168 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
220 |
Q |
| |
|
| |||||||||||||||| ||||| | |||| ||||| |||||||||||||| |
|
|
| T |
39301198 |
aaggtgggaccccttcccggaccctccgtatgtgggag-tttagtgcaccggg |
39301249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 114 - 226
Target Start/End: Original strand, 7368420 - 7368528
Alignment:
| Q |
114 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
213 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||||| |||||||||||||| ||||||||||||||||| ||||| ||||||| ||||||| ||||| |
|
|
| T |
7368420 |
ggaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaat--tggtgggaccccttcccggaccctgcatatgtgggagctctagtg |
7368515 |
T |
 |
| Q |
214 |
caccgggttgccc |
226 |
Q |
| |
|
||||||||||||| |
|
|
| T |
7368516 |
caccgggttgccc |
7368528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 95 - 220
Target Start/End: Original strand, 43574609 - 43574732
Alignment:
| Q |
95 |
ggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgc |
194 |
Q |
| |
|
||||||| |||||||| |||||||| |||||||||| |||||||||||||||||| ||||||| |||| ||||||||||||||||||| ||||| || |
|
|
| T |
43574609 |
ggtcacgtgttcaagtcctggaaacaatctcttgtgtagaaaacagggtaaggctgcgtacaatatacca--aatggtgggaccccttcccggaccctgc |
43574706 |
T |
 |
| Q |
195 |
atatgcgggagctttagtgcaccggg |
220 |
Q |
| |
|
|||||||||||||||| |||||||| |
|
|
| T |
43574707 |
gtatgcgggagctttagagcaccggg |
43574732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 75 - 231
Target Start/End: Original strand, 1405170 - 1405324
Alignment:
| Q |
75 |
ttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgg |
174 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||| |||||||||||||| | ||||||| || ||||| ||| |||||||||||| |||||||| |
|
|
| T |
1405170 |
ttgttgtcatgtgactagaaggtcacgggttcaagtcctggaaacaacctcttatataaaaaatagagtaagtttgcgtacaatacacca--aatggtgg |
1405267 |
T |
 |
| Q |
175 |
gaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
||||| |||| |||| ||||||||||||||| |||| |||||| ||||||||||| |
|
|
| T |
1405268 |
gaccctttcctgaaccctgcatatgcgggagctctagtacaccggattgcccttttt |
1405324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 117 - 229
Target Start/End: Complemental strand, 16880757 - 16880647
Alignment:
| Q |
117 |
aacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcac |
216 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||||||||| ||||||| |||| |||||| |||| || ||||||||||||||||||||| |
|
|
| T |
16880757 |
aacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacacca--aatggtgtgaccacttcccggaccatgcgtatgcgggagctttagtgcac |
16880660 |
T |
 |
| Q |
217 |
cgggttgcccttt |
229 |
Q |
| |
|
|||||| |||||| |
|
|
| T |
16880659 |
cgggtttcccttt |
16880647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 64 - 229
Target Start/End: Original strand, 22187257 - 22187422
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
|||| |||||||||||||||| | |||| |||||||| |||| |||| ||||||| |||||||||||||||||| | |||| |||| ||||||||||| |
|
|
| T |
22187257 |
aactagtaaagttgttgtcatttgactgaaaggtcaccggtttaagtcctggaaacagcctcttgtgtaaaaaacatgataagactgcgtacaatacacc |
22187356 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
|| || || |||||||||||| |||| ||||||| |||||||||||||| | ||||||||||| |
|
|
| T |
22187357 |
aaaaacaatgagaccccttcccaaaccctacatatgcaggagctttagtgcatcaggttgcccttt |
22187422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 68 - 151
Target Start/End: Original strand, 23974756 - 23974839
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgc |
151 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
23974756 |
ggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaagagggtaaggctgc |
23974839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 96 - 189
Target Start/End: Original strand, 41425952 - 41426043
Alignment:
| Q |
96 |
gtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagac |
189 |
Q |
| |
|
||||||||||||||| ||||||||| | ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41425952 |
gtcacgggttcaagttctggaaacaacttattgtgtaaaaaacagggtaaggctgcatacaatacaccaat--tggtgggaccccttcccagac |
41426043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 67 - 231
Target Start/End: Complemental strand, 19143102 - 19142941
Alignment:
| Q |
67 |
tggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaat |
166 |
Q |
| |
|
||||||| ||||||||| || ||| || | ||| ||||||||| ||||||||||||||||||||||| |||||||||||||| |||| |||||||| |
|
|
| T |
19143102 |
tggtaaaattgttgtcacgtgactaaaatgccacaggttcaagtcctggaaacaacctcttgtgtaaaaa-cagggtaaggctgcgtacagtacaccaa- |
19143005 |
T |
 |
| Q |
167 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|||||||||||||||||| |||| || |||||||||| |||||||||| || |||||||||| |
|
|
| T |
19143004 |
-atggtgggaccccttcccggaccatgcgtatgcgggagatttagtgcactggcctgcccttttt |
19142941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 114 - 230
Target Start/End: Original strand, 29334417 - 29334532
Alignment:
| Q |
114 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
213 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||||| ||||||||||| | ||||||||||||| ||||| ||||| || |||| |||| ||||| || |
|
|
| T |
29334417 |
ggaaacagcctcttgtgtaaaaaacaaggtaaggctgcgtacaatacacc-agaatggtgggacccattcccggaccctgcgtatgtgggatctttaatg |
29334515 |
T |
 |
| Q |
214 |
caccgggttgccctttt |
230 |
Q |
| |
|
||||||| ||||||||| |
|
|
| T |
29334516 |
caccgggctgccctttt |
29334532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 138 - 229
Target Start/End: Complemental strand, 34154903 - 34154814
Alignment:
| Q |
138 |
cagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||||||||||||| ||||| |||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
34154903 |
cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcggtagctctagtgcaccgggttgcccttt |
34154814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 88 - 229
Target Start/End: Complemental strand, 42924973 - 42924830
Alignment:
| Q |
88 |
actggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccag |
187 |
Q |
| |
|
|||| ||||||||| |||||||| | ||||||| |||||||||||||||||||||||| ||| ||||||||||||| |||| ||| | |||||||||| |
|
|
| T |
42924973 |
actgaaaggtcacgagttcaagtcctgaaaacaacatcttgtgtaaaaaacagggtaaggttgcgtacaatacaccaaaaatgatggaatcccttcccag |
42924874 |
T |
 |
| Q |
188 |
--accccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
|||| || ||||||| |||||||||||||||| ||| ||||| |
|
|
| T |
42924873 |
acaccctgcgtatgcggaagctttagtgcaccggattgtccttt |
42924830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 158 - 229
Target Start/End: Original strand, 25622524 - 25622595
Alignment:
| Q |
158 |
tacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| || |||||||||||||||||||||||| ||||||||| |
|
|
| T |
25622524 |
tacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggattgcccttt |
25622595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 153 - 230
Target Start/End: Original strand, 16957375 - 16957450
Alignment:
| Q |
153 |
tacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
16957375 |
tacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
16957450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 64 - 225
Target Start/End: Original strand, 30006297 - 30006456
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||| |||| |||||||||||| |||| ||||||| | ||||||| || |||||||||||| | |||| ||||||||||||||| |||| ||||| |
|
|
| T |
30006297 |
aactgataaatttgttgtcatgtgactgaaaggtcatagattcaagtccggaaaacaacctcttatataaacaacagggtaaggctgtgtacattacact |
30006396 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcc |
225 |
Q |
| |
|
| ||||||||||||||||||| | || |||||||||||||||||||||||||||||| |
|
|
| T |
30006397 |
a--aatggtgggaccccttcccggggcctatgtatgcgggagctttagtgcaccgggttgcc |
30006456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 64 - 157
Target Start/End: Complemental strand, 37024717 - 37024626
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaa |
157 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||||| ||||||| |||||||||| |||||||||||||||||| ||||| |
|
|
| T |
37024717 |
aactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgt--aaaacagggtaaggctgcgtacaa |
37024626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 76 - 219
Target Start/End: Original strand, 1850624 - 1850764
Alignment:
| Q |
76 |
tgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtggg |
175 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||| ||||| |||||||||||| |||||||| ||||| ||| ||||||||| || ||||||||| |
|
|
| T |
1850624 |
tgttgtcatgtgactgaaaggtcacgggttcaagtcccggaaataacctcttgtgt-aaaaacagaataagggtgcgtacaatacatca--aatggtggg |
1850720 |
T |
 |
| Q |
176 |
accccttcccagaccccgcatatgcgggagctttagtgcaccgg |
219 |
Q |
| |
|
||| ||||| ||||| || |||||| |||||||||||||||| |
|
|
| T |
1850721 |
accacttcctggaccctgcggatgcggaagctttagtgcaccgg |
1850764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 116 - 217
Target Start/End: Complemental strand, 7097870 - 7097772
Alignment:
| Q |
116 |
aaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgca |
215 |
Q |
| |
|
||||| ||||||||||||||| |||||||||| ||| ||||||||||||| |||||| ||||||||||| |||| || |||||||||||||||||||| |
|
|
| T |
7097870 |
aaacagcctcttgtgtaaaaa-cagggtaaggttgcgtacaatacaccaa--atggtgagaccccttcccgaaccctgcgtatgcgggagctttagtgca |
7097774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 96 - 231
Target Start/End: Complemental strand, 11657835 - 11657697
Alignment:
| Q |
96 |
gtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagg----gtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccc |
191 |
Q |
| |
|
||||||||||||||| | ||||||||||| || ||||||| | | |||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
11657835 |
gtcacgggttcaagttatggaaacaacctattatgtaaaatagtgtaactgtaaggctgcatacaatacaccaa-aatggtgggaccccttcccgaaccc |
11657737 |
T |
 |
| Q |
192 |
cgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
||| | |||||| ||||||| ||||||| |||||||||| |
|
|
| T |
11657736 |
tgcacacgcgggaactttagttcaccgggctgcccttttt |
11657697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 170 - 231
Target Start/End: Complemental strand, 16028683 - 16028622
Alignment:
| Q |
170 |
ggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16028683 |
ggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttttt |
16028622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 68 - 206
Target Start/End: Original strand, 2838754 - 2838890
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaa-ggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaat |
166 |
Q |
| |
|
||||||||||||||||||| |||| || ||||||| | |||||| |||||| | |||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
2838754 |
ggtaaagttgttgtcatgtgactgtaaaggtcacgaggtcaagtctcagaaacagcatcttgtgtaaaa-acagggtaaggctgcgtacaatacacca-- |
2838850 |
T |
 |
| Q |
167 |
aatggtgggaccccttcccagaccccgcatatgcgggagc |
206 |
Q |
| |
|
|||||||||| |||||| | ||||| || ||||||||||| |
|
|
| T |
2838851 |
aatggtgggatcccttctcggaccctgcgtatgcgggagc |
2838890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 114 - 229
Target Start/End: Complemental strand, 12575775 - 12575660
Alignment:
| Q |
114 |
ggaaacaacctcttgtgtaaa-aaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagt |
212 |
Q |
| |
|
||||||| ||||||| ||||| ||||||| ||| | ||| ||||||||||||| |||||||||||||||||| ||||| || ||||| |||||||| || |
|
|
| T |
12575775 |
ggaaacagcctcttgcgtaaataaacaggctaaagttgcgtacaatacaccaa-aatggtgggaccccttcctggaccctgcgtatgcaggagctttggt |
12575677 |
T |
 |
| Q |
213 |
gcaccgggttgcccttt |
229 |
Q |
| |
|
|||||||| |||||||| |
|
|
| T |
12575676 |
gcaccgggctgcccttt |
12575660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 114 - 209
Target Start/End: Complemental strand, 24323818 - 24323725
Alignment:
| Q |
114 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagcttt |
209 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||| || ||||| |||| || ||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
24323818 |
ggaaacaacctcttgtgtaaaagacagggtaagcttgcgtataatactccaa--atagtgggaccccttcccagaccctgtatatgcgggagcttt |
24323725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 114 - 209
Target Start/End: Complemental strand, 24360442 - 24360349
Alignment:
| Q |
114 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagcttt |
209 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||| || ||||| |||| || ||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
24360442 |
ggaaacaacctcttgtgtaaaagacagggtaagcttgcgtataatactccaa--atagtgggaccccttcccagaccctgtatatgcgggagcttt |
24360349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 132 - 230
Target Start/End: Original strand, 3771379 - 3771475
Alignment:
| Q |
132 |
aaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||||||||||||||||| ||| | | |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
3771379 |
aaaaaacagggtaaggctgtgaacaatacaccaat--tggtgggaccccttcccggactctgtgtatgtgggagctttagtgcaccgggctgccctttt |
3771475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 134 - 219
Target Start/End: Complemental strand, 9794471 - 9794388
Alignment:
| Q |
134 |
aaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgg |
219 |
Q |
| |
|
||||||||||||| |||||||||||||||||| || |||||| |||||| ||||||| |||||||| | |||||||||||||||| |
|
|
| T |
9794471 |
aaaacagggtaagactgcatacaatacaccaa--atagtgggatcccttcacagacccagcatatgcagaagctttagtgcaccgg |
9794388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 64 - 230
Target Start/End: Complemental strand, 22861829 - 22861668
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||| ||||||||||||||||| |||| |||||||||| ||||||| ||| || ||||||||||||| | ||||| |||| |||||||| | |
|
|
| T |
22861829 |
aactgataaagttgttgtcatgtgactgaaaggtcacggattcaagtcctagaagcagtctcttgtgtaaaacaa---gtaagactgctcacaatacatc |
22861733 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
|| |||||||||||||||| | |||| ||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
22861732 |
aa--atggtgggaccccttctcgaaccctgcatatgcgggagctctagtgcaccgaattgccctttt |
22861668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 169 - 230
Target Start/End: Original strand, 39801591 - 39801652
Alignment:
| Q |
169 |
tggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||||||||||||||||||||| |||| |
|
|
| T |
39801591 |
tggtgggaccccttcccagaccctacgtatgcgggagctttagtgcaccgggttgccatttt |
39801652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 165 - 229
Target Start/End: Complemental strand, 30877628 - 30877564
Alignment:
| Q |
165 |
ataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
|||| |||||||||||||||| ||||| ||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
30877628 |
ataaaggtgggaccccttcccggaccctgcatatgtgggagctctagtgcaccgggttgcccttt |
30877564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 77 - 189
Target Start/End: Complemental strand, 22908014 - 22907904
Alignment:
| Q |
77 |
gttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtggga |
176 |
Q |
| |
|
||||| |||| |||| ||||||| |||||||||| |||||| ||||||||||||||| ||| |||||| |||||||||||||||| |||||||||| |
|
|
| T |
22908014 |
gttgttatgtgactgaaaggtcaagggttcaagtccaagaaacagcctcttgtgtaaaaa-cagagtaaggttgcatacaatacacca--aatggtggga |
22907918 |
T |
 |
| Q |
177 |
cccct-tcccagac |
189 |
Q |
| |
|
||||| |||||||| |
|
|
| T |
22907917 |
cccctctcccagac |
22907904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 114 - 229
Target Start/End: Complemental strand, 5873434 - 5873322
Alignment:
| Q |
114 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
213 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||||| |||| ||||||||| ||||||||| ||| ||| ||| | || |||||||||||||||||| |
|
|
| T |
5873434 |
ggaaacagcctcttgtgtaaaaat-agggtaaggctaagtacactacaccaat--tggtgggactcctccccggacactgcgtatgcgggagctttagtg |
5873338 |
T |
 |
| Q |
214 |
caccgggttgcccttt |
229 |
Q |
| |
|
|| |||| |||||||| |
|
|
| T |
5873337 |
catcgggatgcccttt |
5873322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 173 - 231
Target Start/End: Complemental strand, 10943900 - 10943843
Alignment:
| Q |
173 |
gggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
||||||||||||| ||||| ||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
10943900 |
gggaccccttcccggaccctgca-atgcgggagctttagtgcaccgggctgcccttttt |
10943843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 88 - 150
Target Start/End: Original strand, 22025539 - 22025601
Alignment:
| Q |
88 |
actggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctg |
150 |
Q |
| |
|
|||| ||||||| |||||||||| ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
22025539 |
actgaaaggtcatgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctg |
22025601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 128 - 217
Target Start/End: Complemental strand, 31694207 - 31694120
Alignment:
| Q |
128 |
gtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
217 |
Q |
| |
|
|||||||||| ||| ||| ||||||||||||||||| || || |||||| |||||||||||| || |||||||||| ||||||||||| |
|
|
| T |
31694207 |
gtgtaaaaaataggctaaagctgcatacaatacacctat--tgatgggactccttcccagaccttgcgtatgcgggagatttagtgcacc |
31694120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 154 - 210
Target Start/End: Complemental strand, 10306548 - 10306493
Alignment:
| Q |
154 |
acaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagcttta |
210 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||||| || ||||||||||||||| |
|
|
| T |
10306548 |
acaatacaccaa-aatggtgggaccccttcccggaccctgcgtatgcgggagcttta |
10306493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 116 - 231
Target Start/End: Complemental strand, 24903807 - 24903694
Alignment:
| Q |
116 |
aaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgca |
215 |
Q |
| |
|
||||| ||| |||||||||||| |||||||| || |||||| ||||||| ||||| ||||||||||| ||| | ||||| |||||| |||| ||||| |
|
|
| T |
24903807 |
aaacagccttttgtgtaaaaaatagggtaagattgtgtacaatccaccaat--tggtgagaccccttcccggacactgcatacgcgggaactttggtgca |
24903710 |
T |
 |
| Q |
216 |
ccgggttgcccttttt |
231 |
Q |
| |
|
||||| || ||||||| |
|
|
| T |
24903709 |
ccgggctgtccttttt |
24903694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 178 - 230
Target Start/End: Original strand, 32354211 - 32354263
Alignment:
| Q |
178 |
cccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
|||||||| ||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32354211 |
cccttcccggaccctgtgtatgcgggagctttagtgcaccgggttgccctttt |
32354263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 167 - 226
Target Start/End: Complemental strand, 21784394 - 21784335
Alignment:
| Q |
167 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccc |
226 |
Q |
| |
|
|||||||||||||||| || ||||| || |||||||||| |||||||||||| ||||||| |
|
|
| T |
21784394 |
aatggtgggacccctttccggaccctgcgtatgcgggaggtttagtgcaccgagttgccc |
21784335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 143 - 217
Target Start/End: Complemental strand, 12477205 - 12477132
Alignment:
| Q |
143 |
taaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
217 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||||||||| || | || ||||| ||||||||||||||| |
|
|
| T |
12477205 |
taaggctgcgtacaatacaccaa-aatggtgggaccccttcccggattctgcgtatgcaagagctttagtgcacc |
12477132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 70 - 230
Target Start/End: Complemental strand, 24313732 - 24313571
Alignment:
| Q |
70 |
taaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctc-ttgtgtaaaaaacagggtaaggctgcatacaatacaccaataa |
168 |
Q |
| |
|
|||||||||||||| | |||| ||||||| | |||||||| |||||||||| | || |||| |||||| | ||||| ||| | ||||||||||| || |
|
|
| T |
24313732 |
taaagttgttgtcacatgactgaaaggtcatgtgttcaagtcttggaaacaacccccttctgtagaaaacaagataaggttgcgttcaatacaccaa-aa |
24313634 |
T |
 |
| Q |
169 |
tggtgggaccccttcccag-accccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
||||||||||||||||| | || | ||||| | ||||||||||||||||| ||||||||| |
|
|
| T |
24313633 |
tggtgggaccccttcccggcgccatgtgtatgctgtagctttagtgcaccgggctgccctttt |
24313571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 70 - 230
Target Start/End: Complemental strand, 24356069 - 24355908
Alignment:
| Q |
70 |
taaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctc-ttgtgtaaaaaacagggtaaggctgcatacaatacaccaataa |
168 |
Q |
| |
|
|||||||||||||| | |||| ||||||| | |||||||| |||||||||| | || |||| |||||| | ||||| ||| | ||||||||||| || |
|
|
| T |
24356069 |
taaagttgttgtcacatgactgaaaggtcatgtgttcaagtcttggaaacaacccccttctgtagaaaacaagataaggttgcgttcaatacaccaa-aa |
24355971 |
T |
 |
| Q |
169 |
tggtgggaccccttcccag-accccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
||||||||||||||||| | || | ||||| | ||||||||||||||||| ||||||||| |
|
|
| T |
24355970 |
tggtgggaccccttcccggcgccatgtgtatgctgtagctttagtgcaccgggctgccctttt |
24355908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 72 - 220
Target Start/End: Complemental strand, 34074717 - 34074573
Alignment:
| Q |
72 |
aagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatgg |
171 |
Q |
| |
|
|||||||||||| | |||| |||||||| |||||||| |||||| |||||||||||||||||| |||||| ||| | |||||||||| ||||| |
|
|
| T |
34074717 |
aagttgttgtcacatgactgaaaggtcacaagttcaagtcctagaaacagcctcttgtgtaaaaaacacagtaaggttgcgttcaatacacca--aatgg |
34074620 |
T |
 |
| Q |
172 |
tgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
220 |
Q |
| |
|
|| |||||||||| |||| || |||| |||||| |||||||||||| |
|
|
| T |
34074619 |
cagggccccttcccaaaccctgcgtatgggggagc--tagtgcaccggg |
34074573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 72 - 149
Target Start/End: Complemental strand, 10634301 - 10634224
Alignment:
| Q |
72 |
aagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggct |
149 |
Q |
| |
|
|||||||||||| || |||| ||||||| |||||||||| ||||||||||| |||| ||||| |||||||||||| |
|
|
| T |
10634301 |
aagttgttgtcaagtgactgaaaggtcatgggttcaagtcctagaaacaacctcgtgtgcaaaaatcagggtaaggct |
10634224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 67 - 108
Target Start/End: Complemental strand, 31362495 - 31362454
Alignment:
| Q |
67 |
tggtaaagttgttgtcatgtaactggaaggtcacgggttcaa |
108 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
31362495 |
tggtaaagttgttgtcatgtgattggaaggtcacgggttcaa |
31362454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 196 - 228
Target Start/End: Complemental strand, 29184094 - 29184062
Alignment:
| Q |
196 |
tatgcgggagctttagtgcaccgggttgccctt |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
29184094 |
tatgcgggagctttagtgcaccgggttgccctt |
29184062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 165 - 217
Target Start/End: Original strand, 29297862 - 29297914
Alignment:
| Q |
165 |
ataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
217 |
Q |
| |
|
|||||||||||| |||||||| ||||||||| || |||| ||||||||||||| |
|
|
| T |
29297862 |
ataatggtgggatcccttcccggaccccgcaaatacgggtgctttagtgcacc |
29297914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 167 - 217
Target Start/End: Complemental strand, 4654477 - 4654427
Alignment:
| Q |
167 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcacc |
217 |
Q |
| |
|
|||||||||| |||||| | |||| ||||||||||||||||||||||||| |
|
|
| T |
4654477 |
aatggtgggatcccttctcgaaccctgcatatgcgggagctttagtgcacc |
4654427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 193 - 227
Target Start/End: Original strand, 11462924 - 11462958
Alignment:
| Q |
193 |
gcatatgcgggagctttagtgcaccgggttgccct |
227 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
11462924 |
gcatatgcgggagctctagtgcaccgggttgccct |
11462958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 182 - 224
Target Start/End: Original strand, 18684361 - 18684403
Alignment:
| Q |
182 |
tcccagaccccgcatatgcgggagctttagtgcaccgggttgc |
224 |
Q |
| |
|
|||||||||| || |||||||||||||||||||| |||||||| |
|
|
| T |
18684361 |
tcccagaccctgcgtatgcgggagctttagtgcatcgggttgc |
18684403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 68 - 110
Target Start/End: Complemental strand, 39079925 - 39079883
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagt |
110 |
Q |
| |
|
||||||||||||||||||| || | |||||||||||||||||| |
|
|
| T |
39079925 |
ggtaaagttgttgtcatgtgacagaaaggtcacgggttcaagt |
39079883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 129 - 182
Target Start/End: Complemental strand, 2432395 - 2432342
Alignment:
| Q |
129 |
tgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggacccctt |
182 |
Q |
| |
|
||||||||||| || |||| |||||| |||||||||| |||||||| ||||||| |
|
|
| T |
2432395 |
tgtaaaaaacaaggcaagggtgcatataatacaccaaaaatggtggaacccctt |
2432342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 187 - 228
Target Start/End: Original strand, 19438759 - 19438800
Alignment:
| Q |
187 |
gaccccgcatatgcgggagctttagtgcaccgggttgccctt |
228 |
Q |
| |
|
||||| ||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
19438759 |
gaccctgcatatgcgggagctctagtgcaccaggttgccctt |
19438800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 175 - 231
Target Start/End: Original strand, 19093894 - 19093950
Alignment:
| Q |
175 |
gaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
||||||| ||| ||||| || |||| ||||||||||||||||||| |||||||||| |
|
|
| T |
19093894 |
gacccctacccggaccctgcgtatgttggagctttagtgcaccgggctgcccttttt |
19093950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 153 - 225
Target Start/End: Complemental strand, 39079826 - 39079755
Alignment:
| Q |
153 |
tacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcc |
225 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |||| | ||| |||||| |||||||||| ||| |||| |
|
|
| T |
39079826 |
tacaatacaccaa-aatggtgggaccccttcccggaccatgtgtatacgggagttttagtgcacagggctgcc |
39079755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 120; Significance: 3e-61; HSPs: 59)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 120; E-Value: 3e-61
Query Start/End: Original strand, 64 - 230
Target Start/End: Complemental strand, 12222080 - 12221913
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
12222080 |
aactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcttggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacacc |
12221981 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagc-tttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
|||||||||||||||||||||| ||||| || ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
12221980 |
aataatggtgggaccccttcccggaccctgcgtatgcgggagcttttagtgcaccgggttgccctttt |
12221913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 75 - 232
Target Start/End: Complemental strand, 29356009 - 29355852
Alignment:
| Q |
75 |
ttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgg |
174 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||| ||||||| |||||||||||| ||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29356009 |
ttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaagaaacagggtaaggctgcgtacaatacaccaataatggtgg |
29355910 |
T |
 |
| Q |
175 |
gaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttta |
232 |
Q |
| |
|
||||||||||| ||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29355909 |
gaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttttta |
29355852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 64 - 231
Target Start/End: Complemental strand, 2166575 - 2166408
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
|||| ||||||||||||| |||| |||| |||||||||||||||||| |||||||||||||||||||||| ||||| ||||| ||| ||||||||||| |
|
|
| T |
2166575 |
aactagtaaagttgttgttatgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaatacaggataaggttgcgtacaatacacc |
2166476 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2166475 |
aataatggtgggaccccttcccggaccctatatattcgggagctttagtgcaccgggttgcccttttt |
2166408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 64 - 231
Target Start/End: Complemental strand, 2178208 - 2178041
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
|||| ||||||||||||| |||| |||| |||||||||||||||||| |||||||||||||||||||||| ||||| ||||| ||| ||||||||||| |
|
|
| T |
2178208 |
aactagtaaagttgttgttatgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaatacaggataaggttgcgtacaatacacc |
2178109 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2178108 |
aataatggtgggaccccttcccggaccctatatattcgggagctttagtgcaccgggttgcccttttt |
2178041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 64 - 231
Target Start/End: Original strand, 1346936 - 1347099
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||||| ||||||| || ||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
1346936 |
aactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagccacttgtgtaaaa--cagggtaaggctgcgtacaatacacc |
1347033 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|| |||||||||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1347034 |
aa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttttt |
1347099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 64 - 230
Target Start/End: Complemental strand, 1354918 - 1354756
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||| ||||||||| ||||||| |||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
1354918 |
aactggtaaagttgttgtcatgtgactgaaaggtcactggttcaagtcctggaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacacc |
1354821 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
|| |||||||||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1354820 |
aa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
1354756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 68 - 231
Target Start/End: Original strand, 9161099 - 9161261
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
167 |
Q |
| |
|
||||||||||||||||||| |||| |||||||| ||||||||| ||||||| ||||||||||||||| ||| |||||||||| ||||||||| ||||| |
|
|
| T |
9161099 |
ggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaaa-cagagtaaggctgcgtacaatacatcaata |
9161197 |
T |
 |
| Q |
168 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|||||||||||||||| | ||||| || ||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
9161198 |
atggtgggaccccttctcggaccctgcgtatgcggaagctttagtgcaccaggttgcccttttt |
9161261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 68 - 225
Target Start/End: Complemental strand, 14975239 - 14975094
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
167 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||| ||||||| |||||||||||||||||| || ||||||||||||| |
|
|
| T |
14975239 |
ggtaaagttgttgtcatgtgactggaaggtcacggattcaagtcctggaaacagcctcttgtgtaaaaaacaagg------------caatacaccaata |
14975152 |
T |
 |
| Q |
168 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcc |
225 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
14975151 |
atggtgggaccccttcccgaaccccgcatatgcgggagttttagtgcaccgggttgcc |
14975094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 64 - 197
Target Start/End: Original strand, 6024205 - 6024338
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||||||| ||||| | |||||| |||||||||||||||||| |||||| |||| ||||||||||| |
|
|
| T |
6024205 |
aactggtaaagttgttgtcatgtgattggaaggtcacggtttcaaatcctagaaacagcctcttgtgtaaaaaacatggtaagactgcgtacaatacacc |
6024304 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcata |
197 |
Q |
| |
|
||||||| ||||||| |||||| ||||||||||| |
|
|
| T |
6024305 |
aataatgatgggacctcttcccggaccccgcata |
6024338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 64 - 231
Target Start/End: Original strand, 1941827 - 1941992
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||| ||| || |||| | | |||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1941827 |
aactggtaaagttgttgtcatctgactggaaggtcgcggattgaagtcatgtaaacaacctcttgtgtaaaaaacagggtaaggctgcgtacaatacacc |
1941926 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|||||||||||||| ||| || | | |||||||||| ||| |||||||| |||||||||||| |
|
|
| T |
1941927 |
--gaatggtgggaccccatcctggatcttgtgtatgcgggagtttttgtgcaccgtgttgcccttttt |
1941992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 156 - 231
Target Start/End: Original strand, 12892071 - 12892146
Alignment:
| Q |
156 |
aatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12892071 |
aatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
12892146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 114 - 232
Target Start/End: Original strand, 26097182 - 26097296
Alignment:
| Q |
114 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
213 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||||| ||||||||||||| ||| ||||||||||||| ||||| ||||||||||||||| ||||| |
|
|
| T |
26097182 |
ggaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atgaagggaccccttcccggaccctgcatatgcgggagctctagtg |
26097277 |
T |
 |
| Q |
214 |
caccgggttgcccttttta |
232 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
26097278 |
caccgggttgcccttttta |
26097296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 114 - 232
Target Start/End: Original strand, 25557747 - 25557861
Alignment:
| Q |
114 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
213 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||||| ||||||||||||| ||| || |||||||||| ||||| ||||||||||||||| ||||| |
|
|
| T |
25557747 |
ggaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atgaaggaaccccttcccggaccctgcatatgcgggagctctagtg |
25557842 |
T |
 |
| Q |
214 |
caccgggttgcccttttta |
232 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
25557843 |
caccgggttgcccttttta |
25557861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 64 - 222
Target Start/End: Complemental strand, 3815240 - 3815084
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| |||| || ||||||||||||||| ||||||| || |||||||||||| | |||| | |||| ||||||||||| |
|
|
| T |
3815240 |
aactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaagtcctggaaacagactattgtgtaaaaaatatggtacgactgcgtacaatacacc |
3815141 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggtt |
222 |
Q |
| |
|
| ||||||||||||| ||||| |||| | ||||||| ||||||||||||||||||| |
|
|
| T |
3815140 |
a--aatggtgggaccctttcccgaaccctacgtatgcggaagctttagtgcaccgggtt |
3815084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 88 - 229
Target Start/End: Complemental strand, 7947511 - 7947371
Alignment:
| Q |
88 |
actggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccag |
187 |
Q |
| |
|
|||| |||||||| ||||||| | |||||||||||| |||||||||| |||||||||||||| ||||||||||||| ||||||||| ||||||||| | |
|
|
| T |
7947511 |
actgaaaggtcaccggttcaactcctggaaacaacctcctgtgtaaaaaccagggtaaggctgcgtacaatacaccaa-aatggtgggcccccttcccgg |
7947413 |
T |
 |
| Q |
188 |
accccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
||| || |||| |||||||||||||||| || |||||||| |
|
|
| T |
7947412 |
accttgcgtatgtgggagctttagtgcacttggctgcccttt |
7947371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 68 - 165
Target Start/End: Complemental strand, 13905138 - 13905041
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaa |
165 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||| |||||| | |||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
13905138 |
ggtaaagttgttgtcatgtgactgaaaggtcacgggctcaagtcctgaaaacgacctcttgtgtaaaaaacagggtaaggctgcatacaattcaccaa |
13905041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 148 - 230
Target Start/End: Original strand, 12885967 - 12886049
Alignment:
| Q |
148 |
ctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
|||| |||||||||| || ||||||||||||||||||||||||| || |||| |||||||||||||||||||||||||||||| |
|
|
| T |
12885967 |
ctgcgtacaatacacaaaaaatggtgggaccccttcccagaccctgcgtatgtgggagctttagtgcaccgggttgccctttt |
12886049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 69 - 230
Target Start/End: Complemental strand, 32728314 - 32728156
Alignment:
| Q |
69 |
gtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataa |
168 |
Q |
| |
|
|||||||||||||||||| |||| |||||||| | ||||||| |||||||||||||| |||||||||||||||||| ||| ||||||| ||||| | |
|
|
| T |
32728314 |
gtaaagttgttgtcatgtgactgaaaggtcacagattcaagttttggaaacaacctcttatgtaaaaaacagggtaagactgtgtacaatataccaa--a |
32728217 |
T |
 |
| Q |
169 |
tggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
| |||| ||| ||||||||||| | ||||||||| |||||||||||| ||||||||||| |
|
|
| T |
32728216 |
tagtggt-ccctttcccagaccctacgtatgcgggaactttagtgcaccatgttgccctttt |
32728156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 64 - 160
Target Start/End: Original strand, 8409215 - 8409311
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatac |
160 |
Q |
| |
|
|||||||||||||||||| |||| |||| |||||||||| ||||||| |||||| |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
8409215 |
aactggtaaagttgttgtaatgtgactgaaaggtcacggattcaagtcctggaaactgcctcttgtgtaaaaaacagggtaaggctgcgtacaatac |
8409311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 64 - 207
Target Start/End: Original strand, 14553484 - 14553626
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||| ||||||||| ||||| | | |||||||||||||| |||||||||||| || |||||||| |
|
|
| T |
14553484 |
aactggtaaagttgttgtcatgtgacta-aaggtcacaggttcaagtcctggaaatagcttcttgtgtaaaaaatagggtaaggctgtgtataatacacc |
14553582 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagct |
207 |
Q |
| |
|
|| | ||||||||||||||| |||||| | |||||||||||| |
|
|
| T |
14553583 |
aaaactggtgggaccccttcgtagaccctgtgtatgcgggagct |
14553626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 93 - 231
Target Start/End: Complemental strand, 18277327 - 18277191
Alignment:
| Q |
93 |
aaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagacccc |
192 |
Q |
| |
|
|||||||||||||||| | ||||||| ||||||||||||||| |||||||||| || |||| ||||||| ||||||||||||||||| |||| | |
|
|
| T |
18277327 |
aaggtcacgggttcaaatcttggaaacagcctcttgtgtaaaaatcagggtaaggttgagtacagaacaccaa--atggtgggaccccttcctagactct |
18277230 |
T |
 |
| Q |
193 |
gcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
| ||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
18277229 |
acgtatgcgggagctttactgcaccgggttgtccttttt |
18277191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 67 - 162
Target Start/End: Original strand, 20400642 - 20400737
Alignment:
| Q |
67 |
tggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacac |
162 |
Q |
| |
|
||||| |||||||||||||| |||| |||||||| ||||||||| | |||||||| |||||||||||||||||||||||| |||| |||| ||||| |
|
|
| T |
20400642 |
tggtatagttgttgtcatgtgactgaaaggtcacaggttcaagttatggaaacaatctcttgtgtaaaaaacagggtaagactgcgtacagtacac |
20400737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 64 - 231
Target Start/End: Original strand, 24097553 - 24097714
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
|||||||||| ||| |||||||| |||| ||||||||| ||| |||| ||| || |||||||| ||||||||||||||||||||| |||| ||| |
|
|
| T |
24097553 |
aactggtaaaattgatgtcatgttactgaaaggtcacgagtttaagtcctcgaaccagcctcttgtataaaaaacagggtaaggctgcttaca----acc |
24097648 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
| ||||||||||||||||||| ||||| || ||||||| |||||||||| || ||||||||||||| |
|
|
| T |
24097649 |
a--aatggtgggaccccttcccggaccctgcgtatgcggaagctttagtgtcccaggttgcccttttt |
24097714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 68 - 229
Target Start/End: Original strand, 12889402 - 12889562
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
167 |
Q |
| |
|
|||||||||||||||| || | || |||||||| ||||||||| | ||||| |||||||||| |||||||||| |||||||||||||||||||| | | |
|
|
| T |
12889402 |
ggtaaagttgttgtcacgtgagtgaaaggtcacaggttcaagtcttgaaaacagcctcttgtgttaaaaacagggcaaggctgcatacaatacaccta-a |
12889500 |
T |
 |
| Q |
168 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
| | ||||||||||| || ||||| | || ||||||||||||||| |||| |||||||| |
|
|
| T |
12889501 |
acgatgggacccctttccggaccctctgtgtgtgggagctttagtgcatcgggctgcccttt |
12889562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 64 - 227
Target Start/End: Complemental strand, 15866200 - 15866041
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||| ||||| | || ||||||| |||||||| | ||||||| |||||| |||||||||||||||| ||||| | |||||||| |
|
|
| T |
15866200 |
aactggtaaagttgttggcatgtgattgaaaggtcatgggttcaattcctggaaacagcctcttaagtaaaaaacagggtaaagctgcgt--aatacacc |
15866103 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccct |
227 |
Q |
| |
|
| ||||||||||||||||||| ||||| || | ||||||| || |||||||| | |||||||| |
|
|
| T |
15866102 |
a--aatggtgggaccccttcccggaccctgcgtttgcgggatctatagtgcactgagttgccct |
15866041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 68 - 228
Target Start/End: Complemental strand, 2755583 - 2755422
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
167 |
Q |
| |
|
||||||||||||||||||| |||| |||||| ||||||||| | ||||| |||||| | ||||| ||| ||||||||| ||||||||||||| | |
|
|
| T |
2755583 |
ggtaaagttgttgtcatgtgactgaaaggtcgtaggttcaagtcttgcaaacatcctcttataccaaaaataggctaaggctgcgtacaatacaccaaaa |
2755484 |
T |
 |
| Q |
168 |
atggtgggaccccttcccagaccccgcatat--gcgggagctttagtgcaccgggttgccctt |
228 |
Q |
| |
|
||||||||| |||||||| | || |||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
2755483 |
atggtgggagtccttcccaaatcctgcatatgcgcgggagctttagtgcacc-ggttgccctt |
2755422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 122 - 220
Target Start/End: Original strand, 19340858 - 19340954
Alignment:
| Q |
122 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccggg |
220 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |||||||||||| |||| ||||||||||||| ||||| || ||||||| |||||||||||| |||| |
|
|
| T |
19340858 |
cctcttgtgtaaaaaacagggtaaggttgca-acaatacaccaa-aatgatgggaccccttcctggacccggcgtatgcggaagctttagtgcaacggg |
19340954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 97 - 218
Target Start/End: Original strand, 33138838 - 33138957
Alignment:
| Q |
97 |
tcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcat |
196 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||||||| ||||||| || |||||||||||| ||||||||||||| || || ||||| | | |
|
|
| T |
33138838 |
tcacgggttcaagtcctggaaacaacctcttgtataaaaaacagagtaaggccgcgtacaatacacca--aatggtgggacccttttccggaccctgtgt |
33138935 |
T |
 |
| Q |
197 |
atgcgggagctttagtgcaccg |
218 |
Q |
| |
|
|||| | ||||||||||||||| |
|
|
| T |
33138936 |
atgcagtagctttagtgcaccg |
33138957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 166 - 231
Target Start/End: Original strand, 6808467 - 6808532
Alignment:
| Q |
166 |
taatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|||||||||||||||||||| ||||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
6808467 |
taatggtgggaccccttcccggaccctgtgtatgcgggagctttagtgcaccgggttgcccttttt |
6808532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 70 - 230
Target Start/End: Original strand, 28007604 - 28007761
Alignment:
| Q |
70 |
taaagttgttgtcatgtaactggaa--ggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
167 |
Q |
| |
|
||||||||||||||||| || ||| |||||||||||||||| ||||| | |||||||||||||| |||||| ||||||| |||||||||||| | |
|
|
| T |
28007604 |
taaagttgttgtcatgtgacatgaaaaggtcacgggttcaagtcctggaaagagcctcttgtgtaaaa--cagggtcaggctgcgtacaatacacca--a |
28007699 |
T |
 |
| Q |
168 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
||| |||||||||||||| ||| | ||||||||| |||| ||||||||||| || ||||||| |
|
|
| T |
28007700 |
atgctgggaccccttccctaacctc-catatgcggaagctctagtgcaccggattaccctttt |
28007761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 88 - 229
Target Start/End: Original strand, 17432336 - 17432483
Alignment:
| Q |
88 |
actggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaagg------ctgcatacaatacaccaataatggtgggacccct |
181 |
Q |
| |
|
|||| |||||||| ||||||||| ||||||||| |||||||||||||||||||||||| ||| |||||||||| || ||||||| |||| | |
|
|
| T |
17432336 |
actgaaaggtcacaggttcaagtcctggaaacaacatcttgtgtaaaaaacagggtaagggtaaggctgtgtacaatacactaaaaatggtgagaccttt |
17432435 |
T |
 |
| Q |
182 |
tcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
|||| || || | ||||||||||||||||||||||||||||||||| |
|
|
| T |
17432436 |
tcccggatcctgtgcatgcgggagctttagtgcaccgggttgcccttt |
17432483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 116 - 231
Target Start/End: Complemental strand, 9671196 - 9671082
Alignment:
| Q |
116 |
aaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgca |
215 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| ||| |||| ||| |||||| ||||||||| || |||| ||| || ||||||||||| |||| |
|
|
| T |
9671196 |
aaacagcctcttgtgtaaaaaacagggtaaggctgcctactttacatcaa-aatggtaggacccctttccgaaccctgcaaatacgggagctttaatgca |
9671098 |
T |
 |
| Q |
216 |
ccgggttgcccttttt |
231 |
Q |
| |
|
|||| |||||||||| |
|
|
| T |
9671097 |
tcgggctgcccttttt |
9671082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 70 - 230
Target Start/End: Complemental strand, 23930283 - 23930126
Alignment:
| Q |
70 |
taaagttgttgtcatgtaactggaaggtcacgggttc-aagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataa |
168 |
Q |
| |
|
||||| ||||||||||| || ||||||||| |||| |||| | ||||||| ||| ||||||||||||| | || | ||| |||||||||||| | |
|
|
| T |
23930283 |
taaagatgttgtcatgtgtctcaaaggtcacgagttccaagtcatggaaacagtctcatgtgtaaaaaacaagata--gttgcgtacaatacaccag--a |
23930188 |
T |
 |
| Q |
169 |
tggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
||||||||||||||| | ||||| || ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
23930187 |
tggtgggaccccttcacggaccctgcttatgcgggagctttagtgcaccgagttgccctttt |
23930126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 88 - 231
Target Start/End: Complemental strand, 3116262 - 3116127
Alignment:
| Q |
88 |
actggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccag |
187 |
Q |
| |
|
|||| ||||||| |||||||||| | |||||||||||||||| |||||| | |||| |||||||||||| ||||||||||||||||| | | |
|
|
| T |
3116262 |
actgaaaggtcatgggttcaagtcatggaaacaacctcttgtataaaaatga--------ctgcgcacaatacaccaaaaatggtgggaccccttctcgg |
3116171 |
T |
 |
| Q |
188 |
accccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
||| || ||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
3116170 |
accttgcgtatgcgggagctttagtacaccggattgcccttttt |
3116127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 155 - 232
Target Start/End: Original strand, 13267788 - 13267863
Alignment:
| Q |
155 |
caatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttta |
232 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||| || ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
13267788 |
caatacaccaa--atggtgggaccccttcctggaccctgcgtatgcgggagcttcagtgcaccgggttgcccttttta |
13267863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 141 - 212
Target Start/End: Original strand, 32579474 - 32579543
Alignment:
| Q |
141 |
ggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagt |
212 |
Q |
| |
|
|||||| |||| |||||||| |||| |||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32579474 |
ggtaagcctgcgtacaataccccaa--atggtgggaccccttcccagaccctgcatatgcgggagctttagt |
32579543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 153 - 229
Target Start/End: Complemental strand, 383834 - 383760
Alignment:
| Q |
153 |
tacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
||||||||||||| || ||||||||||||| ||||||| || ||||||||||||| ||| |||||||||||||||| |
|
|
| T |
383834 |
tacaatacaccaa--attgtgggaccccttctcagaccctgcgtatgcgggagcttcagtccaccgggttgcccttt |
383760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 174 - 231
Target Start/End: Complemental strand, 20906841 - 20906784
Alignment:
| Q |
174 |
ggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||| ||||| |||||| |
|
|
| T |
20906841 |
ggaccccttcccagaccccgcatatgcgggagctttagtgaaccaagttgctcttttt |
20906784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 64 - 211
Target Start/End: Original strand, 24734605 - 24734760
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaa---------aacagggtaaggctgcata |
154 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||| |||||| | ||||||||||||||||||||| |||||||||||| ||| || |
|
|
| T |
24734605 |
aactggtaaagttgttgtcatgtgactgaaaggtcaaaagttcaaatccttgaaacaacctcttgtgtaaaaaaaaaaaaaaacagggtaaggttgcgta |
24734704 |
T |
 |
| Q |
155 |
caatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttag |
211 |
Q |
| |
|
||||||| ||| || |||||||||||||||| || || || ||||| |||||||||| |
|
|
| T |
24734705 |
caatacaacaaaaaaggtgggaccccttcccggatcctgcgtatgc-ggagctttag |
24734760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 114 - 185
Target Start/End: Original strand, 11849075 - 11849145
Alignment:
| Q |
114 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttccc |
185 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||| | ||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
11849075 |
ggaaacaacctcttgtgttaaaaacaggataaagttgcccacaatacaccaa-aatggtgggaccccttccc |
11849145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 70 - 157
Target Start/End: Original strand, 22967149 - 22967235
Alignment:
| Q |
70 |
taaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaa |
157 |
Q |
| |
|
||||||| ||||||||| |||| |||||||| |||||||| | ||||||||| |||||||| ||||| ||| ||||||||||||||| |
|
|
| T |
22967149 |
taaagttattgtcatgtgactgtaaggtcactagttcaagtcatggaaacaacttcttgtgt-aaaaataggataaggctgcatacaa |
22967235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 78 - 227
Target Start/End: Complemental strand, 23240971 - 23240826
Alignment:
| Q |
78 |
ttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggac |
177 |
Q |
| |
|
|||||| || |||| |||||||| ||| ||||| ||||||| |||||||||| ||||||||||||| ||| ||||||| |||||| ||||||||| |
|
|
| T |
23240971 |
ttgtcacgtgactgaaaggtcacaggtgcaagtcctggaaacagcctcttgtgt--aaaacagggtaagtttgcgtacaatataccaat--tggtgggac |
23240876 |
T |
 |
| Q |
178 |
cccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccct |
227 |
Q |
| |
|
|||||| ||| || ||||||||||||||||||||| ||| |||||| |
|
|
| T |
23240875 |
cccttctaggacaatgcgtatgcgggagctttagtgcactgggctgccct |
23240826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 70 - 157
Target Start/End: Complemental strand, 23821244 - 23821158
Alignment:
| Q |
70 |
taaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaa |
157 |
Q |
| |
|
||||||| ||||||||| |||| |||||||| |||||||| | ||||||||| ||||||||| |||| ||| ||||||||||||||| |
|
|
| T |
23821244 |
taaagttattgtcatgtgactgtaaggtcactagttcaagtcatggaaacaacttcttgtgta-aaaataggataaggctgcatacaa |
23821158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 120 - 182
Target Start/End: Original strand, 32068121 - 32068182
Alignment:
| Q |
120 |
aacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggacccctt |
182 |
Q |
| |
|
|||||||||||||||||||||| ||| |||| ||||||||||||| |||||||||||||||| |
|
|
| T |
32068121 |
aacctcttgtgtaaaaaacaggataatgctgtttacaatacaccaa-aatggtgggacccctt |
32068182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 169 - 229
Target Start/End: Complemental strand, 10734965 - 10734905
Alignment:
| Q |
169 |
tggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
||||||| ||||||||| ||||| || ||||||||||||||||| ||||||| |||||||| |
|
|
| T |
10734965 |
tggtgggcccccttcccggaccctgcgtatgcgggagctttagtccaccgggctgcccttt |
10734905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 93 - 157
Target Start/End: Original strand, 17448325 - 17448389
Alignment:
| Q |
93 |
aaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaa |
157 |
Q |
| |
|
|||||||||||||||||| | ||||||| | |||||||||||||||||||||||||| ||||| |
|
|
| T |
17448325 |
aaggtcacgggttcaagttttgaaaacaacattttgtgtaaaaaacagggtaaggctgcgtacaa |
17448389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 149 - 222
Target Start/End: Complemental strand, 16895778 - 16895704
Alignment:
| Q |
149 |
tgcatacaatacaccaataatggtggga-ccccttcccagaccccgcatatgcgggagctttagtgcaccgggtt |
222 |
Q |
| |
|
|||||||||||||| || |||||||||| ||||||||| ||||| |||||| || || |||||||||||||||| |
|
|
| T |
16895778 |
tgcatacaatacactaaaaatggtgggacccccttcccggaccctacatatgtggaagttttagtgcaccgggtt |
16895704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 194 - 232
Target Start/End: Original strand, 25997749 - 25997787
Alignment:
| Q |
194 |
catatgcgggagctttagtgcaccgggttgcccttttta |
232 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25997749 |
catatgcgggagctctagtgcaccgggttgcccttttta |
25997787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 152 - 219
Target Start/End: Complemental strand, 16916064 - 16915996
Alignment:
| Q |
152 |
atacaatacaccaataatggtgggacc-ccttcccagaccccgcatatgcgggagctttagtgcaccgg |
219 |
Q |
| |
|
||||||||||| || |||||| ||||| |||||| |||||| |||||| ||||||||||||||||||| |
|
|
| T |
16916064 |
atacaatacactaaaaatggtaggacctccttcctagaccctacatatgtgggagctttagtgcaccgg |
16915996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 114 - 182
Target Start/End: Original strand, 31990096 - 31990163
Alignment:
| Q |
114 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggacccctt |
182 |
Q |
| |
|
|||||||| |||||||||||||||| | | ||| ||||||||||||||||| ||||| |||||||||| |
|
|
| T |
31990096 |
ggaaacaatctcttgtgtaaaaaacggagcaagcttgcatacaatacaccaa-aatggcgggacccctt |
31990163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 125 - 231
Target Start/End: Complemental strand, 24751176 - 24751066
Alignment:
| Q |
125 |
cttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcg-----ggagctttagtgcaccgg |
219 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||| || ||||||| ||||||||| | ||| || |||||| | |||||||||||||||| |
|
|
| T |
24751176 |
cttgtgtaaaaaatagggtaagactgcgtacaatacactaa-aatggtgagaccccttcacgaaccgtgcgtatgcgtatgagcagctttagtgcaccgg |
24751078 |
T |
 |
| Q |
220 |
gttgcccttttt |
231 |
Q |
| |
|
|||||| ||||| |
|
|
| T |
24751077 |
gttgccattttt |
24751066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 196 - 231
Target Start/End: Complemental strand, 30786407 - 30786372
Alignment:
| Q |
196 |
tatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30786407 |
tatgcgggagctttagtgcaccgggttgcctttttt |
30786372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 169 - 219
Target Start/End: Original strand, 11395836 - 11395886
Alignment:
| Q |
169 |
tggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgg |
219 |
Q |
| |
|
||||||||||||||||| || || || ||||||||||||||||| |||||| |
|
|
| T |
11395836 |
tggtgggaccccttcccggatcctgcgtatgcgggagctttagtccaccgg |
11395886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 133 - 227
Target Start/End: Original strand, 18254559 - 18254651
Alignment:
| Q |
133 |
aaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccct |
227 |
Q |
| |
|
||||||||||||| |||||||||||||| |||| ||| ||||||||||||| ||||| | | ||| ||||| ||| |||||||||| |||||| |
|
|
| T |
18254559 |
aaaaacagggtaaagctgcatacaatac-ccaa-aatagtgggaccccttcacagactctacgtatatgggagttttggtgcaccgggctgccct |
18254651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 170 - 232
Target Start/End: Complemental strand, 33922916 - 33922854
Alignment:
| Q |
170 |
ggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttta |
232 |
Q |
| |
|
||||| |||||||||| ||||| || |||| ||||||||||||||| |||||||||||||| |
|
|
| T |
33922916 |
ggtggcaccccttcccggaccctgcttatgttggagctttagtgcacatggttgcccttttta |
33922854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 114 - 234
Target Start/End: Original strand, 12228380 - 12228498
Alignment:
| Q |
114 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
213 |
Q |
| |
|
||||||| ||||||| ||||||| ||| ||| | ||| |||||||||||| || |||||||||||||||| | || | || | ||||| ||||||| |
|
|
| T |
12228380 |
ggaaacagactcttgtttaaaaaataggataaagttgcgtacaatacaccag--atagtgggaccccttcccataacctacgtaagtgggagttttagtg |
12228477 |
T |
 |
| Q |
214 |
caccgggttgccctttttagt |
234 |
Q |
| |
|
|| ||||||||||||||||| |
|
|
| T |
12228478 |
tactgggttgccctttttagt |
12228498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 64 - 120
Target Start/End: Original strand, 8417444 - 8417500
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaaca |
120 |
Q |
| |
|
||||||||||||||||||||||| |||| || |||||| ||||| || | ||||||| |
|
|
| T |
8417444 |
aactggtaaagttgttgtcatgtgactgaaatgtcacgagttcaggtcatggaaaca |
8417500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 131 - 163
Target Start/End: Complemental strand, 14341166 - 14341134
Alignment:
| Q |
131 |
taaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
14341166 |
taaaaaacagggtaaggctgcgtacaatacacc |
14341134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 174 - 210
Target Start/End: Complemental strand, 29016337 - 29016301
Alignment:
| Q |
174 |
ggaccccttcccagaccccgcatatgcgggagcttta |
210 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||| |
|
|
| T |
29016337 |
ggaccccttcccagaccctgcgtatgcgggagcttta |
29016301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 118; Significance: 5e-60; HSPs: 70)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 118; E-Value: 5e-60
Query Start/End: Original strand, 64 - 229
Target Start/End: Original strand, 14530290 - 14530455
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||||| ||||||| |||||||| ||||||||||||||||||| | ||||||||||| |
|
|
| T |
14530290 |
aactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaacagggtaaggctacgtacaatacacc |
14530389 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
|||||||||||||||||||||| ||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
14530390 |
aataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
14530455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 64 - 229
Target Start/End: Original strand, 10543670 - 10543835
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||| ||||||||||||||||| |||| |||||||||||||||||| |||||| |||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
10543670 |
aactgataaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacggcctcttgtgtaaaaaacagggtaaggctgcgtacaatacacc |
10543769 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
|| ||||||||||||||||||| ||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
10543770 |
aaaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
10543835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 64 - 230
Target Start/End: Complemental strand, 8455479 - 8455315
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| |||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
8455479 |
aactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacacagggtaaggctgcgtacaatacacc |
8455380 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
| ||||||||||||||||||| ||||| || ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
8455379 |
a--aatggtgggaccccttcccggaccctgcgtatgccggagctttagtgcaccgggttgccctttt |
8455315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 70 - 230
Target Start/End: Original strand, 5841006 - 5841166
Alignment:
| Q |
70 |
taaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataat |
169 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |||||| ||| |||||||||||| ||||||||| ||| ||||||||| ||||||| |
|
|
| T |
5841006 |
taaagttgttgtcatgtgactggaaggtcacgggttcaagtcctagaaacagccttttgtgtaaaaaatagggtaaggatgcgtacaatacatcaataat |
5841105 |
T |
 |
| Q |
170 |
ggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
5841106 |
ggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgagttgccctttt |
5841166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 58 - 230
Target Start/End: Complemental strand, 24200794 - 24200622
Alignment:
| Q |
58 |
tgatgtaactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaa |
157 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||| || ||||||||||||||| ||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24200794 |
tgatgcaactggtaaagttgttgtcatgtgactgaaaagtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaa |
24200695 |
T |
 |
| Q |
158 |
tacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
|||||||| |||||||||| |||||||| ||||| | |||| | |||||||||||||||||||||||||||| |
|
|
| T |
24200694 |
tacaccaaaaatggtgggaacccttcccggaccctgagtatgtgagagctttagtgcaccgggttgccctttt |
24200622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 64 - 230
Target Start/End: Original strand, 11514408 - 11514571
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||| | ||||||| |||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
11514408 |
aactggtaaagttgttgtcatgtgactggaaggtcacgggttcaactcctggaaacagcctcttgtgtaaaaaacaaagtaaggctgcgtacaatacacc |
11514507 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
| |||||||||| |||||||||||||| || |||||||||||||||||||||||| |||||||||| |
|
|
| T |
11514508 |
a--aatggtggga-cccttcccagaccctgcgtatgcgggagctttagtgcaccggattgccctttt |
11514571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 64 - 231
Target Start/End: Original strand, 17667974 - 17668139
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| ||||| ||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
17667974 |
aactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaagaacctcttgtgtaaaaatcagggtaaggctgcgtacaatacacc |
17668073 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
| |||||||| |||||||| | |||| || ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
17668074 |
a--aatggtggaaccccttctcgaaccctgcgtatatgggagctttagtgcaccgggttgcccttttt |
17668139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 64 - 230
Target Start/End: Complemental strand, 21779422 - 21779260
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||| ||||||||||||||| |||| |||||||||||||||||| ||| ||| |||||||||||||| |||||||||| ||| ||||||||||| |
|
|
| T |
21779422 |
aactggtgaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggagacagcctcttgtgtaaaa--cagggtaaggttgcgtacaatacacc |
21779325 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
|| |||||||||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
21779324 |
aa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
21779260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 64 - 229
Target Start/End: Complemental strand, 25079881 - 25079717
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaa-cagggtaaggctgcatacaatacac |
162 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| || ||||||| ||| |||||||||| |
|
|
| T |
25079881 |
aactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcttagaaacaacctcttgtgtaaaaaaacaaggtaaggatgcgtacaatacac |
25079782 |
T |
 |
| Q |
163 |
caataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
| | |||||||||||||||||| ||||| || ||||| ||||||||||||||||||||||||||| |
|
|
| T |
25079781 |
cga--atggtgggaccccttcccggaccctgcgtatgcaagagctttagtgcaccgggttgcccttt |
25079717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 67 - 229
Target Start/End: Complemental strand, 40417031 - 40416871
Alignment:
| Q |
67 |
tggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaat |
166 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| | |||||||||||||||| |||||||||||| ||||||| |||||||||||||| |
|
|
| T |
40417031 |
tggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcatggaaacaacctcttgtataaaaaacagggaaaggctgtgtacaatacaccaat |
40416932 |
T |
 |
| Q |
167 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
|| |||||||| || ||||| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40416931 |
--tgatgggacccttttttggaccctgcatatgcgagagctttagtgcaccgggttgcccttt |
40416871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 68 - 230
Target Start/End: Original strand, 9671156 - 9671315
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaag-gtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaat |
166 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||||||| | ||||||| |||||||||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
9671156 |
ggtaaagttgttgtcatgtgactggaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa- |
9671252 |
T |
 |
| Q |
167 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
|||||||||||||||||| ||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
9671253 |
-atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
9671315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 67 - 231
Target Start/End: Complemental strand, 25249897 - 25249736
Alignment:
| Q |
67 |
tggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaat |
166 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||||||| | ||||||| ||||||||| | ||||||||||||||||| |||||||||||| |
|
|
| T |
25249897 |
tggtaaagttgttgtcatgtgactgtaaggtcacgggttcaagtcatggaaacagtctcttgtgt-acaaacagggtaaggctgcgtacaatacacca-- |
25249801 |
T |
 |
| Q |
167 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|||||||||| |||||||| |||| || |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
25249800 |
aatggtgggatcccttcccgaaccctgcgtatgcgtgagctttagtgcaccgggttgcccttttt |
25249736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 64 - 231
Target Start/End: Original strand, 17623536 - 17623701
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
17623536 |
aactggtaaagttgttgtcatgcgactggaaggtcacgggttcaagtcctcgaaacaacctcttgtgtaaaaatcagggtaaggctgcgtacaatacacc |
17623635 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
| |||||||| |||||||||| | || || |||| || ||||||||||||| |||||||||||||| |
|
|
| T |
17623636 |
a--aatggtggaaccccttcccgaatcctgcgtatgtggaagctttagtgcactgggttgcccttttt |
17623701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 83 - 231
Target Start/End: Original strand, 10546153 - 10546300
Alignment:
| Q |
83 |
atgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaa-cagggtaaggctgcatacaatacaccaataatggtgggacccct |
181 |
Q |
| |
|
|||| |||| |||||||||||||||||| ||||||| |||||||| ||||||| |||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
10546153 |
atgtgactgaaaggtcacgggttcaagtcctggaaacatcctcttgtataaaaaaacagggtaaggctgcgtacaatacaccaa--atggtgggacccct |
10546250 |
T |
 |
| Q |
182 |
tcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|||| ||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
10546251 |
tcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttttt |
10546300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 66 - 230
Target Start/End: Complemental strand, 39914467 - 39914305
Alignment:
| Q |
66 |
ctggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaa-aaaacagggtaaggctgcatacaatacacca |
164 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |||||| |||||||||||||||||||| |||||||||||||| || ||||||||||| |
|
|
| T |
39914467 |
ctggtaaagttgttgtcatgtgactggaaggtcacgggatcaagtactggaaacaacctcttgtgtaaaaaaacagggtaaggatgtgtacaatacacc- |
39914369 |
T |
 |
| Q |
165 |
ataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
|||||||||||||||| || ||||| || |||||||||||||||||||| |||||||||||||| |
|
|
| T |
39914368 |
-gaatggtgggacccctt-cctgaccctgcgtatgcgggagctttagtgcatcgggttgccctttt |
39914305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 84; E-Value: 9e-40
Query Start/End: Original strand, 64 - 229
Target Start/End: Original strand, 23397738 - 23397899
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||| |||||||||| ||||||| |||||||||| |||| ||||||||||| | ||||||||||| |
|
|
| T |
23397738 |
aactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacagcctcttgtgt--aaaatagggtaaggctacgtacaatacacc |
23397835 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
| ||||||||||||||||| | ||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
23397836 |
a--aatggtgggaccccttctcggaccctacatatgcgggagctctagtgcaccgggttgcccttt |
23397899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 83 - 231
Target Start/End: Original strand, 14444720 - 14444865
Alignment:
| Q |
83 |
atgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggacccctt |
182 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||| ||||||||||||||| ||||||||||||| ||| ||||||||| ||||||||||||||| |
|
|
| T |
14444720 |
atgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaa-cagggtaaggctgtgtacgatacaccaa--atggtgggacccctt |
14444816 |
T |
 |
| Q |
183 |
cccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
||| ||||| || |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
14444817 |
cccggaccctgcgtatgcgggagctttagtgcaccaggttgcccttttt |
14444865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 79; E-Value: 9e-37
Query Start/End: Original strand, 64 - 232
Target Start/End: Original strand, 17896231 - 17896398
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaac-agggtaaggctgcatacaatacac |
162 |
Q |
| |
|
||||||||||||||||||||||| || | |||||||||| ||||||| ||||||||||||||||||||||| ||||||||||||| ||||||| || |
|
|
| T |
17896231 |
aactggtaaagttgttgtcatgtgaccgaaaggtcacggattcaagtcctagaaacaacctcttgtgtaaaaaaatagggtaaggctgcgtacaatatac |
17896330 |
T |
 |
| Q |
163 |
caataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttta |
232 |
Q |
| |
|
||| |||||||||||||||| | ||||| || |||| ||||||||||||||| || ||||||||||||| |
|
|
| T |
17896331 |
caa--atggtgggaccccttctcggaccctgcgtatgtgggagctttagtgcatcgagttgcccttttta |
17896398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 79; E-Value: 9e-37
Query Start/End: Original strand, 70 - 232
Target Start/End: Complemental strand, 31158598 - 31158436
Alignment:
| Q |
70 |
taaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataat |
169 |
Q |
| |
|
||||||||||||||||| |||| ||||||| ||||| |||| ||||| ||||||| ||||||||||||||||| ||||||||||| ||||| ||| |
|
|
| T |
31158598 |
taaagttgttgtcatgtgactgaaaggtcaagggttaaagtcttcaaaacagcctcttgcgtaaaaaacagggtaagattgcatacaataaaccaaaaat |
31158499 |
T |
 |
| Q |
170 |
ggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttta |
232 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||||| |||| | ||| |||||||| |
|
|
| T |
31158498 |
ggtgggaccccttcccagaccctgcgtatgcgggagctttagtacacctgattgtccttttta |
31158436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 64 - 219
Target Start/End: Complemental strand, 12024081 - 12023929
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||||| ||||||| ||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
12024081 |
aactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgta-aaaacagggtaaggctgcgtacaatacacc |
12023983 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgg |
219 |
Q |
| |
|
| |||||||||||||| |||| ||||| || ||| || ||||||| |||||||| |
|
|
| T |
12023982 |
a--aatggtgggaccccctcccggaccctgcgtatttggaagctttaatgcaccgg |
12023929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 64 - 231
Target Start/End: Original strand, 7214506 - 7214673
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||| |||||||||| ||||||| ||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
7214506 |
aactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcttggaaacagtctcttgtgtaaaatacagggtaaggctgcgtacaatacaca |
7214605 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|| ||||||| || |||||| | ||| | || |||||| ||| ||||||||||| ||||||| ||||| |
|
|
| T |
7214606 |
aaaaatggtgagatcccttctcggacactgcgtatgcgagagttttagtgcaccaggttgcctttttt |
7214673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 67 - 209
Target Start/End: Complemental strand, 32781448 - 32781308
Alignment:
| Q |
67 |
tggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaat |
166 |
Q |
| |
|
|||||||||||||| |||| ||| ||||||||| |||||||| ||||||||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
32781448 |
tggtaaagttgttgcaatgttgctgaaaggtcacgagttcaagtctcggaaacaacctcttgtgtaaaaaacagggtaagactgcgtacaatacacca-- |
32781351 |
T |
 |
| Q |
167 |
aatggtgggaccccttcccagaccccgcatatgcgggagcttt |
209 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
32781350 |
aatggtgggaccccttcccagaccctgtgtatgcgggagcttt |
32781308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 68 - 232
Target Start/End: Complemental strand, 21377232 - 21377071
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
167 |
Q |
| |
|
||||||||||||||||||| |||| ||||| ||| |||||||| | |||||| ||||||||||||||||||||||||||||| |||||| ||||| | |
|
|
| T |
21377232 |
ggtaaagttgttgtcatgtgactgaaaggttacgagttcaagtcatagaaacatcctcttgtgtaaaaaacagggtaaggctgggtacaatgcacca--a |
21377135 |
T |
 |
| Q |
168 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttta |
232 |
Q |
| |
|
|||||||||||||||||| |||| || |||| ||||||||| |||||||| | ||||||||||| |
|
|
| T |
21377134 |
atggtgggaccccttcccgaaccctgcgtatgtgggagcttt-gtgcaccgagctgcccttttta |
21377071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 64 - 232
Target Start/End: Original strand, 27573593 - 27573758
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||| ||||||||| ||| |||| |||||||||| | ||||| ||||||||||| ||||||||||| |
|
|
| T |
27573593 |
aactggtaaagttgttgtcatgtgactgaaaggtcattggttcaagtccgggcaacagcctcttgtgt-ataaacatggtaaggctgcgtacaatacacc |
27573691 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttta |
232 |
Q |
| |
|
| |||||||| ||| |||||| |||| | |||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
27573692 |
a--aatggtggaaccatttcccaaaccctgtgtatgtgggagctttagtgcatcgggttgcccttttta |
27573758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 68 - 209
Target Start/End: Original strand, 33795261 - 33795400
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatac-aatacaccaat |
166 |
Q |
| |
|
|||||||||||||||| || | || |||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| ||| |||||||| |
|
|
| T |
33795261 |
ggtaaagttgttgtcacgtgattgaaaggtcacgggttcaagtcccggaaacaacctcttgggtaaaaaacagggtaaggctgcgtacaaatacacc--- |
33795357 |
T |
 |
| Q |
167 |
aatggtgggaccccttcccagaccccgcatatgcgggagcttt |
209 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
33795358 |
tatggtgggaccccttcccagaccctgtgtatgcgggagcttt |
33795400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 64 - 191
Target Start/End: Original strand, 22371029 - 22371151
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||| |||| ||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
22371029 |
aactggtaaagttgttgtcatgtgactgggaggtcacgggttcaagtcctggaaacagcctcgtgt---aaaaacagggtaaggctgcgtacaatacacc |
22371125 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccc |
191 |
Q |
| |
|
| ||||||||||||||||||| ||||| |
|
|
| T |
22371126 |
a--aatggtgggaccccttcccggaccc |
22371151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 114 - 231
Target Start/End: Original strand, 36871515 - 36871628
Alignment:
| Q |
114 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
213 |
Q |
| |
|
||||||| |||||||||| |||| |||||||||||||| ||||||||||||| |||||||||||||||||| |||| || |||||||||||||||||| |
|
|
| T |
36871515 |
ggaaacagcctcttgtgtgaaaa-cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggacct-gcgtatgcgggagctttagtg |
36871610 |
T |
 |
| Q |
214 |
caccgggttgcccttttt |
231 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
36871611 |
caccgggttgcccttttt |
36871628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 64 - 231
Target Start/End: Complemental strand, 19977877 - 19977712
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||| ||||||||||||||| || | |||||||||||||||||| ||||||| |||||| ||||||||| ||| ||||| ||| ||||||||||| |
|
|
| T |
19977877 |
aactggtgaagttgttgtcatgtgaccgaaaggtcacgggttcaagttctggaaacagcctcttttgtaaaaaataggataaggttgcgtacaatacacc |
19977778 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
| |||||||||| |||||||| ||| | |||||||||||||||||||||| | || |||||||| |
|
|
| T |
19977777 |
a--aatggtgggatcccttcccgaaccttgtgtatgcgggagctttagtgcaccagattacccttttt |
19977712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 64 - 231
Target Start/End: Complemental strand, 24860149 - 24859986
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||| ||||||| ||| ||||||||||||| ||||||||| || |||| |||||| ||||||||||| |
|
|
| T |
24860149 |
aactggtaaaattgttgtcatgtgactggaaggttacgggtttaagccctggaaacaacctctggtgtaaaaa-catggta-ggctgcgtacaatacacc |
24860052 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|| ||||| | |||||||| | ||||| || |||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
24860051 |
aa--atggtagaaccccttctcggaccctgcgtatgcgggagctttagtgcaccggattgcctttttt |
24859986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 114 - 229
Target Start/End: Complemental strand, 40762347 - 40762234
Alignment:
| Q |
114 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
213 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||||| | ||||||||||||| |||||||||||| |||| ||||| || |||| ||||||||||||| |
|
|
| T |
40762347 |
ggaaacagcctcttgtgtaaaaaactgggtaaggctacgtacaatacaccaa--atggtgggaccctttcctggaccctgcgtatgtgggagctttagtg |
40762250 |
T |
 |
| Q |
214 |
caccgggttgcccttt |
229 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
40762249 |
caccgggttgcccttt |
40762234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 68 - 226
Target Start/End: Complemental strand, 4516510 - 4516354
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
167 |
Q |
| |
|
|||||||||||||||| || |||| |||||||| ||||||| |||||| ||||||||||||||||||||| || ||||| |||||||||||||| |
|
|
| T |
4516510 |
ggtaaagttgttgtcacgtgactgaaaggtcacatattcaagttctagaaacagcctcttgtgtaaaaaacagggcaacgctgcgtacaatacaccaat- |
4516412 |
T |
 |
| Q |
168 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccc |
226 |
Q |
| |
|
||||||||||||||||| ||||| || |||| || |||||||||| |||||| ||||| |
|
|
| T |
4516411 |
-tggtgggaccccttcccggaccctgcgtatgtggaagctttagtgtaccgggctgccc |
4516354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 67 - 230
Target Start/End: Original strand, 44643497 - 44643659
Alignment:
| Q |
67 |
tggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgt-aaaaaacagggtaaggctgcatacaatacaccaa |
165 |
Q |
| |
|
|||||||||||| |||||| |||| ||||||||| |||||||| |||| | |||||| || ||||||||| |||||||||| |||||| |||| |
|
|
| T |
44643497 |
tggtaaagttgtcatcatgtgactgaaaggtcacgtgttcaagttctagaaagagcctcttccgtaaaaaaacagagtaaggctgcgtacaatgtacca- |
44643595 |
T |
 |
| Q |
166 |
taatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
||||||||||||||||||||||||| || ||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
44643596 |
-aatggtgggaccccttcccagaccctgcgtatgcgggagccttagtgcaccgggctgccctttt |
44643659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 70 - 184
Target Start/End: Original strand, 5450263 - 5450376
Alignment:
| Q |
70 |
taaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgt-aaaaaacagggtaaggctgcatacaatacaccaataa |
168 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||| | |||||||||||||||||| |||||||| ||||||||||| |||||||||||| || |
|
|
| T |
5450263 |
taaagttgttgtcatgtgactgaaaggtcacgggttcaattcctggaaacaacctcttgtgtaaaaaaacatggtaaggctgcgtacaatacacca--aa |
5450360 |
T |
 |
| Q |
169 |
tggtgggaccccttcc |
184 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
5450361 |
gggtgggaccccttcc |
5450376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 81 - 217
Target Start/End: Original strand, 19614981 - 19615116
Alignment:
| Q |
81 |
tcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggacccc |
180 |
Q |
| |
|
|||||| |||| |||||||||||||||||| |||||| |||||||| |||||||||||||||| |||| ||||||| ||||||||| || ||||||| |
|
|
| T |
19614981 |
tcatgtgactgaaaggtcacgggttcaagtccttgaaacatcctcttgtataaaaaacagggtaagactgcgtacaatataccaataatagt-ggacccc |
19615079 |
T |
 |
| Q |
181 |
ttcccagaccccgcatatgcgggagctttagtgcacc |
217 |
Q |
| |
|
||||| |||| || ||||| |||||||||||||||| |
|
|
| T |
19615080 |
ttcccgaaccctgcgtatgcaggagctttagtgcacc |
19615116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 67 - 229
Target Start/End: Original strand, 14544038 - 14544201
Alignment:
| Q |
67 |
tggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgta-aaaaacagggtaaggctgcatacaatacaccaa |
165 |
Q |
| |
|
|||||||||||||||||||| |||| ||||| || ||| || || ||||||| ||||||||||| |||||||||||||| |||| | ||||| | || |
|
|
| T |
14544038 |
tggtaaagttgttgtcatgtgactgaaaggttacaggtccaggtactggaaacagcctcttgtgtagaaaaacagggtaagactgcgtgcaataaccaaa |
14544137 |
T |
 |
| Q |
166 |
taatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
|||||| ||||||||||| ||||| || |||||||||||||||||||||| |||||||||| |
|
|
| T |
14544138 |
aaatggtcggaccccttccgggaccctgcgtatgcgggagctttagtgcaccaagttgcccttt |
14544201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 68 - 210
Target Start/End: Complemental strand, 44521532 - 44521392
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
167 |
Q |
| |
|
|||||||||||| ||| || |||| ||||||||| |||||| | |||||||| ||||||||||||||||| |||||||||||||| ||||||||| | |
|
|
| T |
44521532 |
ggtaaagttgttatcacgtgactgaaaggtcacgcgttcaaatcttggaaacaatctcttgtgtaaaaaacaaggtaaggctgcatataatacacca--a |
44521435 |
T |
 |
| Q |
168 |
atggtgggaccccttcccagaccccgcatatgcgggagcttta |
210 |
Q |
| |
|
|||| |||| |||||||||||| |||||| ||||||||||| |
|
|
| T |
44521434 |
atggcgggagcccttcccagacattgcatatacgggagcttta |
44521392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 69 - 213
Target Start/End: Complemental strand, 99421 - 99281
Alignment:
| Q |
69 |
gtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataa |
168 |
Q |
| |
|
||||||||||||||| || |||| |||||||||||||||||| |||||| ||||| ||||||||||| || |||||||| |||||||||||| || |
|
|
| T |
99421 |
gtaaagttgttgtcacgtgactgaaaggtcacgggttcaagtcctagaaacagcctct--tgtaaaaaacatggcaaggctgcgtacaatacacca--aa |
99326 |
T |
 |
| Q |
169 |
tggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
213 |
Q |
| |
|
|||||| |||||||| ||||||| | |||||||||||||||||| |
|
|
| T |
99325 |
tggtggaaccccttctcagaccctgtgtatgcgggagctttagtg |
99281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 64 - 164
Target Start/End: Original strand, 17705467 - 17705567
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||||||||||||||||| |||||| ||||||||||||| ||||| ||||||||| ||||||||||| |
|
|
| T |
17705467 |
aactggtaaagttgttgtcatgtgactagaaggtcacgggttcaagtcctggaaaccgcctcttgtgtaaacaacagagtaaggctgtgtacaatacacc |
17705566 |
T |
 |
| Q |
164 |
a |
164 |
Q |
| |
|
| |
|
|
| T |
17705567 |
a |
17705567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 132 - 216
Target Start/End: Original strand, 24890451 - 24890533
Alignment:
| Q |
132 |
aaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcac |
216 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| ||||||||||||||||| ||||| || ||||| ||||||||||||||| |
|
|
| T |
24890451 |
aaaaaacaaggtaaggctgcatacaatacaccaat--tggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcac |
24890533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 64 - 234
Target Start/End: Complemental strand, 26684785 - 26684615
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaaca-acctcttgtgtaaaaaac-agggtaaggctgcatacaataca |
161 |
Q |
| |
|
||||||||||||||||||||||| | || ||||||| |||| |||| | ||||| ||||||||||||||||| | ||||||||||| ||||||| | |
|
|
| T |
26684785 |
aactggtaaagttgttgtcatgtgattgaaaggtcaaaggtttaagtcctgaaaacagacctcttgtgtaaaaaaatatggtaaggctgcgtacaatata |
26684686 |
T |
 |
| Q |
162 |
ccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttttagt |
234 |
Q |
| |
|
| || ||||||||||| |||||| |||| || ||||||||||||||| |||||||| ||| |||||||||| |
|
|
| T |
26684685 |
ctaa--atggtgggacctcttcccgaaccctgcgtatgcgggagctttaatgcaccggattgtcctttttagt |
26684615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 68 - 191
Target Start/End: Complemental strand, 23145857 - 23145736
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
167 |
Q |
| |
|
|||||||||||||| || |||| |||||||||||||||||| | ||||| |||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
23145857 |
ggtaaagttgttgtagcgtgactgaaaggtcacgggttcaagtcttgaaaacagactcttgtgtaaaaaacagtgtaaggctgcgtacaatacaccaat- |
23145759 |
T |
 |
| Q |
168 |
atggtgggaccccttcccagaccc |
191 |
Q |
| |
|
||||||||||| ||||| ||||| |
|
|
| T |
23145758 |
-tggtgggaccctttcccggaccc |
23145736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 68 - 191
Target Start/End: Complemental strand, 23557647 - 23557526
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
167 |
Q |
| |
|
|||||||||||||| || |||| |||||||||||||||||| | ||||| |||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
23557647 |
ggtaaagttgttgtagcgtgactgaaaggtcacgggttcaagtcttgaaaacagactcttgtgtaaaaaacagtgtaaggctgcgtacaatacaccaat- |
23557549 |
T |
 |
| Q |
168 |
atggtgggaccccttcccagaccc |
191 |
Q |
| |
|
||||||||||| ||||| ||||| |
|
|
| T |
23557548 |
-tggtgggaccctttcccggaccc |
23557526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 127 - 229
Target Start/End: Original strand, 25632544 - 25632644
Alignment:
| Q |
127 |
tgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccc |
226 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||| ||||||||| ||||||| ||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
25632544 |
tgtgtaaaaaacaggataaggctgcgtacaatacaccaa--atggtgggattccttcccgaaccttacgtatgcgggagctttagtgcaccgggttgccc |
25632641 |
T |
 |
| Q |
227 |
ttt |
229 |
Q |
| |
|
||| |
|
|
| T |
25632642 |
ttt |
25632644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 63 - 146
Target Start/End: Original strand, 44604825 - 44604907
Alignment:
| Q |
63 |
taactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaag |
146 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||| ||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
44604825 |
taactgctaaagttgttgtcatgtgactggaaggtcacaggttcaagtcctggaaacaacctcttgtgt-aaaaacagggtaag |
44604907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 72 - 229
Target Start/End: Complemental strand, 17380391 - 17380238
Alignment:
| Q |
72 |
aagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatgg |
171 |
Q |
| |
|
||||||||||||||| || | |||||||||||||||||| |||||||||||||||||| | ||||||||||||| || | |||||||||| |||| |
|
|
| T |
17380391 |
aagttgttgtcatgtgaccgaaaggtcacgggttcaagtcttggaaacaacctcttgtgt-ataaacagggtaaggttgtgtgcaatacacca--aatga |
17380295 |
T |
 |
| Q |
172 |
tgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
||| ||||||||| ||||| || ||||||||||||| |||||||||| | |||||| |
|
|
| T |
17380294 |
tggaaccccttcctggaccctgcggatgcgggagcttt-gtgcaccgggcttcccttt |
17380238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 114 - 231
Target Start/End: Original strand, 30826059 - 30826172
Alignment:
| Q |
114 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtg |
213 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||| ||| ||||||||||||| ||||||| |||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
30826059 |
ggaaacagcctcttgtgtaaaaat-agggtaaggttgcgtacaatacaccaa--atggtggaaccc-ttcccagaccctacatatgcgggagctttagtg |
30826154 |
T |
 |
| Q |
214 |
caccgggttgcccttttt |
231 |
Q |
| |
|
|||| | ||| ||||||| |
|
|
| T |
30826155 |
caccagattgtccttttt |
30826172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 169 - 230
Target Start/End: Original strand, 34080176 - 34080237
Alignment:
| Q |
169 |
tggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
34080176 |
tggtgggaccccttcccggaccctgcatatgcgggagttttagtgcaccgggttgccctttt |
34080237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 68 - 165
Target Start/End: Complemental strand, 29420048 - 29419947
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacaggg----taaggctgcatacaatacacc |
163 |
Q |
| |
|
|||||||||||||||| | |||| ||||||||| |||||||| ||||||||||||||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
29420048 |
ggtaaagttgttgtcacatgactgaaaggtcacgagttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaagtaaggctgcgtacaatacacc |
29419949 |
T |
 |
| Q |
164 |
aa |
165 |
Q |
| |
|
|| |
|
|
| T |
29419948 |
aa |
29419947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 155 - 230
Target Start/End: Original strand, 23488544 - 23488619
Alignment:
| Q |
155 |
caatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
|||||||| || ||||||||||||||||||| ||||| || |||||| |||||||||||||||||||||| ||||| |
|
|
| T |
23488544 |
caatacacaaaaaatggtgggaccccttcccggaccctgcgtatgcgagagctttagtgcaccgggttgctctttt |
23488619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 77 - 231
Target Start/End: Original strand, 25641487 - 25641638
Alignment:
| Q |
77 |
gttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtggga |
176 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||| ||||||| | | |||||| |||||||||||| | ||| |||||||||||| ||| |||||| |
|
|
| T |
25641487 |
gttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcattttgtgt-gaaaacagggtaaagttgcgtacaatacacca--aattgtggga |
25641583 |
T |
 |
| Q |
177 |
ccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
||||||||| | || || |||||| ||||||||||| ||||| ||| ||||||| |
|
|
| T |
25641584 |
ccccttcccgaatcctgcgtatgcgagagctttagtgaaccggattgtccttttt |
25641638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 168 - 227
Target Start/End: Original strand, 41409936 - 41409995
Alignment:
| Q |
168 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccct |
227 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
41409936 |
atggtgggaccccttcccggaccctgcatatgcgggagcttcagtgcaccgggttgccct |
41409995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 175 - 229
Target Start/End: Complemental strand, 3633762 - 3633708
Alignment:
| Q |
175 |
gaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3633762 |
gaccccttcccggaccccgcatatgcgggagctttagtgcaccgagttgcccttt |
3633708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 86 - 219
Target Start/End: Original strand, 17471542 - 17471675
Alignment:
| Q |
86 |
taactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaa-cagggtaaggctgcatacaatacaccaataatggtgggaccccttcc |
184 |
Q |
| |
|
|||||| || ||||| ||||||||| |||||| |||||||||||||||| |||| |||| |||| ||||||| ||||| |||| || |||||||||| |
|
|
| T |
17471542 |
taactgaaatgtcacaggttcaagtctcagaaacagcctcttgtgtaaaaaaacaggataagactgcgtacaatataccaa-aatgatgagaccccttcc |
17471640 |
T |
 |
| Q |
185 |
cagaccccgcatatgcgggagctttagtgcaccgg |
219 |
Q |
| |
|
| ||||| || |||||||||| ||||||||||||| |
|
|
| T |
17471641 |
ctgaccctgcctatgcgggagttttagtgcaccgg |
17471675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 168 - 228
Target Start/End: Complemental strand, 40579810 - 40579750
Alignment:
| Q |
168 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctt |
228 |
Q |
| |
|
|||||||||||||||||| ||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
40579810 |
atggtgggaccccttcccggaccctgagtatgcgggagctttagtgcaccgggttgccctt |
40579750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 101 - 231
Target Start/End: Complemental strand, 15296533 - 15296404
Alignment:
| Q |
101 |
gggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgc |
200 |
Q |
| |
|
|||||||||| ||||||| ||| |||||||||| ||||||||||||||| ||||||| ||||| ||| |||||| |||||| | ||||| || |||| |
|
|
| T |
15296533 |
gggttcaagtcccggaaacagcctgttgtgtaaaatacagggtaaggctgcgtacaatataccaa-aatagtgggatcccttctcggaccctgcgtatgt |
15296435 |
T |
 |
| Q |
201 |
gggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|| |||||| |||| || || |||||||||| |
|
|
| T |
15296434 |
ggaagctttggtgcgccaggctgcccttttt |
15296404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 169 - 231
Target Start/End: Original strand, 34766330 - 34766392
Alignment:
| Q |
169 |
tggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
||||||||||||||||| ||||| || |||||||||||||||||||| |||||| |||||||| |
|
|
| T |
34766330 |
tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaacgggtttcccttttt |
34766392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 178 - 231
Target Start/End: Complemental strand, 39189555 - 39189502
Alignment:
| Q |
178 |
cccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
39189555 |
cccttcccggaccccgcatatgcgggagctctagtgcaccgggttgcctttttt |
39189502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 116 - 217
Target Start/End: Complemental strand, 44449495 - 44449395
Alignment:
| Q |
116 |
aaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgca |
215 |
Q |
| |
|
||||||||||||| | ||||||||| ||||||||| ||||||||||||| ||| ||||||||||||||| ||||| || | || ||||| |||| |||| |
|
|
| T |
44449495 |
aaacaacctcttgaatgaaaaacaggataaggctgcgtacaatacaccaa-aatagtgggaccccttcccggaccctgcgtttgtgggagttttaatgca |
44449397 |
T |
 |
| Q |
216 |
cc |
217 |
Q |
| |
|
|| |
|
|
| T |
44449396 |
cc |
44449395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 141 - 228
Target Start/End: Complemental strand, 13245181 - 13245096
Alignment:
| Q |
141 |
ggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctt |
228 |
Q |
| |
|
||||||||||| |||| ||||| || |||||||||||||||||| |||| |||||| |||||||||||||| | |||||||||||| |
|
|
| T |
13245181 |
ggtaaggctgcgtacattacactaa--atggtgggaccccttcccggaccatgcatatacgggagctttagtgtatcgggttgccctt |
13245096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 165 - 230
Target Start/End: Original strand, 1289093 - 1289159
Alignment:
| Q |
165 |
ataatggtgggaccccttcccagaccccgcatatgcgggagc-tttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
||||||||||||||||||||| || | |||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
1289093 |
ataatggtgggaccccttcccggatcatgcatatgcgggagcttttagtgcaccggattgccctttt |
1289159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 181 - 230
Target Start/End: Original strand, 22371199 - 22371248
Alignment:
| Q |
181 |
ttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
||||| ||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
22371199 |
ttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
22371248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 69 - 231
Target Start/End: Complemental strand, 45235976 - 45235815
Alignment:
| Q |
69 |
gtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaa-aacagggtaaggctgcatacaatacaccaata |
167 |
Q |
| |
|
||||||||||| |||||| |||| ||| ||||| |||||||| |||||| ||||| ||||||| || ||||||||||| | | ||||||| || |
|
|
| T |
45235976 |
gtaaagttgttctcatgtgactgaaagatcacgagttcaagtcctagaaacagtctcttctgtaaaataatagggtaaggctacgtgtaatacacaaa-- |
45235879 |
T |
 |
| Q |
168 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
||||||||||||||| |||||||| | ||||| |||||||||||| ||| ||||||| |||| |
|
|
| T |
45235878 |
atggtgggaccccttaccagaccctacgtatgcaggagctttagtgtaccaagttgcccctttt |
45235815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 174 - 229
Target Start/End: Original strand, 8575975 - 8576030
Alignment:
| Q |
174 |
ggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
|||||||||||| ||||| || |||| ||||||||||||||||| ||||||||||| |
|
|
| T |
8575975 |
ggaccccttcccggaccctgcgtatgtgggagctttagtgcaccaggttgcccttt |
8576030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 167 - 226
Target Start/End: Original strand, 31525779 - 31525838
Alignment:
| Q |
167 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccc |
226 |
Q |
| |
|
|||| |||||||| || |||||||| ||||||||||||||||||||| ||||| |||||| |
|
|
| T |
31525779 |
aatgatgggaccctttgccagaccctgcatatgcgggagctttagtgtaccggattgccc |
31525838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 167 - 221
Target Start/End: Original strand, 31523304 - 31523358
Alignment:
| Q |
167 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
221 |
Q |
| |
|
|||||||| |||| |||||| |||| |||||||||||||||||||||||| |||| |
|
|
| T |
31523304 |
aatggtggaaccctttcccaaaccctgcatatgcgggagctttagtgcactgggt |
31523358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 181 - 225
Target Start/End: Complemental strand, 124962 - 124918
Alignment:
| Q |
181 |
ttcccagaccccgcatatgcgggagctttagtgcaccgggttgcc |
225 |
Q |
| |
|
||||| ||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
124962 |
ttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc |
124918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 135 - 229
Target Start/End: Complemental strand, 19185837 - 19185743
Alignment:
| Q |
135 |
aaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
||||| ||||| | ||| |||||| ||| || |||||||| ||||||||| ||||| || ||||||||||||||||| || || ||| |||||| |
|
|
| T |
19185837 |
aaacatggtaaagttgcgtacaatgcacaaaaaatggtggaaccccttcctggaccctgcgtatgcgggagctttagtacatcgagttacccttt |
19185743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 182 - 232
Target Start/End: Complemental strand, 23053012 - 23052962
Alignment:
| Q |
182 |
tcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttta |
232 |
Q |
| |
|
|||||||||| || ||||| |||||||| |||||||||| ||||||||||| |
|
|
| T |
23053012 |
tcccagaccctgcgtatgcaggagcttttgtgcaccgggctgcccttttta |
23052962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 167 - 216
Target Start/End: Original strand, 4794875 - 4794924
Alignment:
| Q |
167 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcac |
216 |
Q |
| |
|
|||| |||||||||||||| || || ||||||||||||||| |||||||| |
|
|
| T |
4794875 |
aatgatgggaccccttcccggatcctgcatatgcgggagctctagtgcac |
4794924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 93 - 165
Target Start/End: Complemental strand, 12315785 - 12315714
Alignment:
| Q |
93 |
aaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaa |
165 |
Q |
| |
|
||||||||| |||||||| | ||||||| | |||| | |||||||||||||||| ||| ||||||||||||| |
|
|
| T |
12315785 |
aaggtcacgagttcaagtcatggaaacagcttcttat-taaaaaacagggtaagactgtgtacaatacaccaa |
12315714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 114; Significance: 1e-57; HSPs: 4)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 67 - 231
Target Start/End: Original strand, 46806 - 46968
Alignment:
| Q |
67 |
tggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaat |
166 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||||| |||||||||||||||||||||||| ||||||||| ||| |||||||||||| |
|
|
| T |
46806 |
tggtaaagttgttgtcatgtgactagaaggtcacgggttcaagtgctggaaacaacctcttgtgtaaaaaatagggtaaggttgcgtacaatacacca-- |
46903 |
T |
 |
| Q |
167 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
||||||||||||||||||| ||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
46904 |
aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttttt |
46968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 64 - 231
Target Start/End: Complemental strand, 24930 - 24770
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||| |||||||||| | ||| |||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
24930 |
aactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtca-----acagcctcttgtgtaaaaaacagggtaaggctgcgtacaacacacc |
24836 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|| |||||||||||||||||| |||| || |||||||||||||||||||| | ||||||||||||| |
|
|
| T |
24835 |
aa--atggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcagccggttgcccttttt |
24770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #3
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 139 - 215
Target Start/End: Complemental strand, 46796 - 46721
Alignment:
| Q |
139 |
agggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgca |
215 |
Q |
| |
|
||||||||| ||||||||||| ||||| ||||||||||||||||||||||||| || ||||||||||||||| |||| |
|
|
| T |
46796 |
agggtaaggatgcatacaatataccaa-aatggtgggaccccttcccagaccctgcgtatgcgggagctttaatgca |
46721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #4
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 114 - 230
Target Start/End: Original strand, 43681 - 43794
Alignment:
| Q |
114 |
ggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcc-cagaccccgcatatgcgggagctttagt |
212 |
Q |
| |
|
||||||| | |||||||||||| || ||||||||||| ||||||||||||| ||||||||||||||| | | ||||| ||||||||||||||| |||| |
|
|
| T |
43681 |
ggaaacagcgtcttgtgtaaaa--caaggtaaggctgcgtacaatacaccaa--atggtgggacccctttctcggaccctgcatatgcgggagctctagt |
43776 |
T |
 |
| Q |
213 |
gcaccgggttgccctttt |
230 |
Q |
| |
|
|||| | ||||||||||| |
|
|
| T |
43777 |
gcactgagttgccctttt |
43794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0049 (Bit Score: 102; Significance: 2e-50; HSPs: 1)
Name: scaffold0049
Description:
Target: scaffold0049; HSP #1
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 64 - 229
Target Start/End: Original strand, 58949 - 59114
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
|||||||||| || ||||||||| |||| |||||||||||||||||| ||||||| |||||||| |||||||||||||||| |||| ||||||||||| |
|
|
| T |
58949 |
aactggtaaacttattgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaacagggtaagactgcgtacaatacacc |
59048 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
|| ||||||||||||||||||||||| | || |||||||||||||||||||| ||||||||||||| |
|
|
| T |
59049 |
aaaaatggtgggaccccttcccagactctgcgtatgcgggagctttagtgcatcgggttgcccttt |
59114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0311 (Bit Score: 100; Significance: 3e-49; HSPs: 1)
Name: scaffold0311
Description:
Target: scaffold0311; HSP #1
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 64 - 230
Target Start/End: Original strand, 10782 - 10946
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||| | ||||||||||||||||||||||||||||| |||||| | ||||||||| |
|
|
| T |
10782 |
aactggtaaagttgttgtcatgtgactggaaggtcacgggttcaaggtctgaaaacaacctcttgtgtaaaaaacagggtagggctgcgtccaatacacc |
10881 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
|| |||||||||||||||||| ||||| || ||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
10882 |
aa--atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcactgggttgctctttt |
10946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0168 (Bit Score: 98; Significance: 4e-48; HSPs: 1)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 64 - 231
Target Start/End: Original strand, 30551 - 30714
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||| ||||||||| ||||||| |||||||||||||| ||||||| |||||| ||||||||||| |
|
|
| T |
30551 |
aactggtaaagttgttgtcatgtgactgaaaggtcaccggttcaagtcctggaaacagcctcttgtgtaaaa--cagggtagggctgcgtacaatacacc |
30648 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|| |||||||||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30649 |
aa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttttt |
30714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0258 (Bit Score: 90; Significance: 2e-43; HSPs: 1)
Name: scaffold0258
Description:
Target: scaffold0258; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 68 - 232
Target Start/End: Complemental strand, 13182 - 13021
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
167 |
Q |
| |
|
||||||||||||||||||| |||| |||||||| ||||||||| ||||||| ||||||| ||||||| || ||||||||||| ||||||||||| | |
|
|
| T |
13182 |
ggtaaagttgttgtcatgtgactgaaaggtcaccggttcaagtcctggaaacagcctcttgcgtaaaaa-caaggtaaggctgcgtacaatacaccga-- |
13086 |
T |
 |
| Q |
168 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttta |
232 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
13085 |
atggtgggaccccttcccagaccctgcgtatgcgggggctttagtgcaccgggttgcccttttta |
13021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1176 (Bit Score: 85; Significance: 2e-40; HSPs: 1)
Name: scaffold1176
Description:
Target: scaffold1176; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 67 - 225
Target Start/End: Complemental strand, 1745 - 1591
Alignment:
| Q |
67 |
tggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaat |
166 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||| |||||||||| | |||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
1745 |
tggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctgaaaacaacctcttgtgt--aaaacaggataaggctgcatacaatacacca-- |
1650 |
T |
 |
| Q |
167 |
aatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcc |
225 |
Q |
| |
|
|||| |||||||||||||| ||||| || |||||||||||||||||||||| ||||||| |
|
|
| T |
1649 |
aatgatgggaccccttcccggacccggcgtatgcgggagctttagtgcaccaggttgcc |
1591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187 (Bit Score: 82; Significance: 1e-38; HSPs: 2)
Name: scaffold0187
Description:
Target: scaffold0187; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 64 - 227
Target Start/End: Complemental strand, 10211 - 10052
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||||| ||||||| |||||||||| ||||||| ||||| |||| ||||||||||| |
|
|
| T |
10211 |
aactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgt--aaaacagagtaagactgcgtacaatacacc |
10114 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccct |
227 |
Q |
| |
|
| ||| ||||||||||||||| ||||| |||||||| |||||| |||||||||||||||||| |
|
|
| T |
10113 |
a--aatagtgggaccccttcccggaccctgcatatgcaggagctccagtgcaccgggttgccct |
10052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 64 - 227
Target Start/End: Complemental strand, 20539 - 20380
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||||| ||||||| |||||||||| ||||||| ||||| |||| ||||||||||| |
|
|
| T |
20539 |
aactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgt--aaaacagagtaagactgcgtacaatacacc |
20442 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccct |
227 |
Q |
| |
|
| ||| ||||||||||||||| ||||| |||||||| |||||| |||||||||||||||||| |
|
|
| T |
20441 |
a--aatagtgggaccccttcccggaccctgcatatgcaggagctccagtgcaccgggttgccct |
20380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0015 (Bit Score: 80; Significance: 2e-37; HSPs: 1)
Name: scaffold0015
Description:
Target: scaffold0015; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 101 - 230
Target Start/End: Complemental strand, 48758 - 48633
Alignment:
| Q |
101 |
gggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgc |
200 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||| |||||||||||||| ||||||||||||| |||||||||||||||||| ||||| |||||||| |
|
|
| T |
48758 |
gggttcaagtggtggaaacagcctcttgtgtaaaa--cagggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgc |
48663 |
T |
 |
| Q |
201 |
gggagctttagtgcaccgggttgccctttt |
230 |
Q |
| |
|
||||||| |||||||||||||||||||||| |
|
|
| T |
48662 |
gggagctctagtgcaccgggttgccctttt |
48633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0223 (Bit Score: 76; Significance: 5e-35; HSPs: 1)
Name: scaffold0223
Description:
Target: scaffold0223; HSP #1
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 64 - 229
Target Start/End: Original strand, 11104 - 11264
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
|||||||||||||||| | |||| |||| |||||||||||||||||| ||||||| |||||||||||||| | || ||||||||| ||||||||||| |
|
|
| T |
11104 |
aactggtaaagttgttct-atgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacaaag--taaggctgcttacaatacacc |
11200 |
T |
 |
| Q |
164 |
aataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
229 |
Q |
| |
|
|| |||||||||| ||||||| ||||| ||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
11201 |
aa--atggtgggacaccttcccggaccctgcatatgcgggagctctagtgcaccaggttgcccttt |
11264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0254 (Bit Score: 73; Significance: 3e-33; HSPs: 1)
Name: scaffold0254
Description:
Target: scaffold0254; HSP #1
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 64 - 191
Target Start/End: Original strand, 4129 - 4257
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacacc |
163 |
Q |
| |
|
|||| ||||||||||||| |||| |||| |||||||||||||||||| |||||||||||||||||||||| ||||| ||||| ||| ||||||||||| |
|
|
| T |
4129 |
aactagtaaagttgttgttatgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaatacaggataaggttgcgtacaatacacc |
4228 |
T |
 |
| Q |
164 |
aataa-tggtgggaccccttcccagaccc |
191 |
Q |
| |
|
||||| ||||||||||||||||| ||||| |
|
|
| T |
4229 |
aataattggtgggaccccttcccggaccc |
4257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0180 (Bit Score: 61; Significance: 5e-26; HSPs: 1)
Name: scaffold0180
Description:
Target: scaffold0180; HSP #1
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 140 - 231
Target Start/End: Complemental strand, 24220 - 24131
Alignment:
| Q |
140 |
gggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||||||||| ||||| ||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
24220 |
gggtaaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggattgcccttttt |
24131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0018 (Bit Score: 60; Significance: 2e-25; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 123 - 229
Target Start/End: Complemental strand, 72971 - 72867
Alignment:
| Q |
123 |
ctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggtt |
222 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||||||| ||||| | |||||||||| || || || |||||||||||||||||||||| |||| |
|
|
| T |
72971 |
ctcttgtgtaaaaaacacggtaaggctgcctacaatacaccaa--atggtagtaccccttcccggaacctgcgtatgcgggagctttagtgcaccaggtt |
72874 |
T |
 |
| Q |
223 |
gcccttt |
229 |
Q |
| |
|
||||||| |
|
|
| T |
72873 |
gcccttt |
72867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 57; Significance: 1e-23; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 64 - 178
Target Start/End: Complemental strand, 226569 - 226456
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgt-aaaaaacagggtaaggctgcatacaatacac |
162 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||| ||||||| |||||| |||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
226569 |
aactggtaaagttgttgtcatgtgactgaaaggtcacggattcaagtcctagaaacagcctcttgtctaaaaaaacagggtaaggctgcatacaatacat |
226470 |
T |
 |
| Q |
163 |
caataatggtgggacc |
178 |
Q |
| |
|
|| |||||||||||| |
|
|
| T |
226469 |
ca--aatggtgggacc |
226456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0167 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: scaffold0167
Description:
Target: scaffold0167; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 190
Target Start/End: Original strand, 23606 - 23695
Alignment:
| Q |
99 |
acgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagacc |
190 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||||||| ||||||| |||||| | || |||||||||||||||||||||||| |
|
|
| T |
23606 |
acgggttcaagtcttgcaaacaacctcttgtgtaaaaaacagggtgaggctgcgtacaatgtagca--aatggtgggaccccttcccagacc |
23695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036 (Bit Score: 44; Significance: 7e-16; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 64 - 184
Target Start/End: Complemental strand, 35182 - 35062
Alignment:
| Q |
64 |
aactggtaaagttg-ttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaa-aaaacagggtaaggctgcatacaataca |
161 |
Q |
| |
|
||||||||||||| ||||||||| |||| |||||||||||||||||| | ||||| ||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
35182 |
aactggtaaagtttattgtcatgtgactgtaaggtcacgggttcaagtcctgaaaacagtctcttgtgtgtgaaaacagggtaaggctgcgtacaataca |
35083 |
T |
 |
| Q |
162 |
ccaataatggtgggaccccttcc |
184 |
Q |
| |
|
||| ||||||||||||| |||| |
|
|
| T |
35082 |
cca--aatggtgggaccctttcc |
35062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0954 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: scaffold0954
Description:
Target: scaffold0954; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 122 - 229
Target Start/End: Original strand, 3574 - 3679
Alignment:
| Q |
122 |
cctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggt |
221 |
Q |
| |
|
|||||||||||||| | | ||||||||||| || |||||||| | ||| |||||||||||||| |||| || ||||||| ||||||||||||||| || |
|
|
| T |
3574 |
cctcttgtgtaaaatataaggtaaggctgcgtataatacaccga--atgatgggaccccttcccgaaccctgcgtatgcggcagctttagtgcaccgagt |
3671 |
T |
 |
| Q |
222 |
tgcccttt |
229 |
Q |
| |
|
| |||||| |
|
|
| T |
3672 |
ttcccttt |
3679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 68 - 179
Target Start/End: Original strand, 32906 - 33016
Alignment:
| Q |
68 |
ggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaata |
167 |
Q |
| |
|
|||| |||||||| || || ||| ||||||| |||||||||| | |||| |||||||| |||||||||||| ||||| ||| |||||||||||||| | |
|
|
| T |
32906 |
ggtatagttgttgccacgtgacttaaaggtcatgggttcaagtccgcgaaaaaacctcttctgtaaaaaacagagtaagactgtatacaatacaccaa-a |
33004 |
T |
 |
| Q |
168 |
atggtgggaccc |
179 |
Q |
| |
|
||||||||||| |
|
|
| T |
33005 |
ttggtgggaccc |
33016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0116 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: scaffold0116
Description:
Target: scaffold0116; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 66 - 136
Target Start/End: Original strand, 8865 - 8935
Alignment:
| Q |
66 |
ctggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaa |
136 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||| ||||||| | ||||||||| ||||||||||||| |
|
|
| T |
8865 |
ctggtaaagttgttgtcatgtgactgtaaggtcacaggttcaattcctggaaacaacttcttgtgtaaaaa |
8935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 64 - 110
Target Start/End: Original strand, 83847 - 83893
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagt |
110 |
Q |
| |
|
|||| |||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
83847 |
aactagtaaagttgttgtcatgtgactgaaaggtcacgggttcaagt |
83893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0194 (Bit Score: 29; Significance: 0.0000006; HSPs: 2)
Name: scaffold0194
Description:
Target: scaffold0194; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 70 - 110
Target Start/End: Original strand, 24642 - 24682
Alignment:
| Q |
70 |
taaagttgttgtcatgtaactggaaggtcacgggttcaagt |
110 |
Q |
| |
|
|||||||||||||| || |||| |||||||||||||||||| |
|
|
| T |
24642 |
taaagttgttgtcaagtgactgtaaggtcacgggttcaagt |
24682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0194; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 140 - 231
Target Start/End: Original strand, 24696 - 24785
Alignment:
| Q |
140 |
gggtaaggctgcatacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
231 |
Q |
| |
|
||||||| |||| || |||||||||| || |||| |||||| |||||||| || ||| ||||||||| |||||||| | ||||||||||| |
|
|
| T |
24696 |
gggtaagactgcgtataatacaccaa--atagtggaccccctttccagaccctgcgtatacgggagcttcagtgcacctgattgcccttttt |
24785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0031
Description:
Target: scaffold0031; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 64 - 136
Target Start/End: Original strand, 43101 - 43173
Alignment:
| Q |
64 |
aactggtaaagttgttgtcatgtaactggaaggtcacgggttcaagtgagggaaacaacctcttgtgtaaaaa |
136 |
Q |
| |
|
||||||||||||| ||||||||| | || ||||||||| ||||| || |||||| ||||||||||||||| |
|
|
| T |
43101 |
aactggtaaagttattgtcatgtgattgaaaggtcacgagttcaggtcctagaaacagcctcttgtgtaaaaa |
43173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University