View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0879_high_13 (Length: 246)
Name: NF0879_high_13
Description: NF0879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0879_high_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 19 - 233
Target Start/End: Complemental strand, 34857358 - 34857144
Alignment:
Q |
19 |
aggtcagaagtatcatatacacagttgtatagatgaaataaatagacatttaaagaatcgcggtctctggatgatgttggacaactttttcctctgttgt |
118 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34857358 |
aggtcagaagtatcatatacacagttgtatagatgaaataaatagacatttaaagaatcgcggtctctggatgatgttggacaactttttcctctgttgt |
34857259 |
T |
 |
Q |
119 |
gcccttcaaaaggagaagggggtggaatatatgcaatagtaatcactaacagttctataatatgaatatcccttgactattaaagttggtaactgttatg |
218 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
34857258 |
gcccttcaaaaggagaagggggtggaatatatgcaatagtaatccctaacagttctataatatgaatatcccttgactattaaagtttgtaactgttatg |
34857159 |
T |
 |
Q |
219 |
cagcctacctatgat |
233 |
Q |
|
|
||||||||||||||| |
|
|
T |
34857158 |
cagcctacctatgat |
34857144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 710 times since January 2019
Visitors: 6719