View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0879_high_15 (Length: 211)
Name: NF0879_high_15
Description: NF0879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0879_high_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 1 - 130
Target Start/End: Complemental strand, 34857273 - 34857144
Alignment:
| Q |
1 |
tttttcctctgttgtgcccttcaaaaggagaagggggtggaatatatgcaatagtaatcactaacagttctataatatgaatatcccttgactattaaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34857273 |
tttttcctctgttgtgcccttcaaaaggagaagggggtggaatatatgcaatagtaatccctaacagttctataatatgaatatcccttgactattaaag |
34857174 |
T |
|
| Q |
101 |
ttggtaactgttatgcagcctacctatgat |
130 |
Q |
| |
|
|| ||||||||||||||||||||||||||| |
|
|
| T |
34857173 |
tttgtaactgttatgcagcctacctatgat |
34857144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 400 times since January 2019
Visitors: 6714