View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0879_high_2 (Length: 382)
Name: NF0879_high_2
Description: NF0879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0879_high_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-106; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 123 - 353
Target Start/End: Complemental strand, 11346259 - 11346026
Alignment:
Q |
123 |
ggacaaattgttttgcttttgttagggttaacacttcaacctaaaccgccgaactcagaaacccttccaaaggttgaagaagataacaaggtattacaag |
222 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11346259 |
ggacaaattgttttgcttttgttagggttaacacttcaacctaaaccgccgaactcggaaacccttccaaaggttgaagaagataacaaggtattacaag |
11346160 |
T |
 |
Q |
223 |
ttgatgatgatg---atgaagaagaaggaaaaggacatgaaaaagaataagttaccattaccaccagtgttccttcccgacgatctcatagccgaaatcc |
319 |
Q |
|
|
|||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||| |
|
|
T |
11346159 |
ttgatgatgatgatgatgaagaagaaggaaaagaacatgaaaaagaataagttaccattaccacctgtgttccttcccaccgatctcatagccgaaatcc |
11346060 |
T |
 |
Q |
320 |
tatcattacttaacgtgaaaacccttgtccaatt |
353 |
Q |
|
|
||||||||||||||||||||||| |||||||||| |
|
|
T |
11346059 |
tatcattacttaacgtgaaaaccattgtccaatt |
11346026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 174 - 246
Target Start/End: Complemental strand, 11360098 - 11360026
Alignment:
Q |
174 |
aactcagaaacccttccaaaggttgaagaagataacaaggtattacaagttgatgatgatgatgaagaagaag |
246 |
Q |
|
|
|||||| |||||||| | ||||||||||||||||| ||||||| ||||||||||| || | |||||||||| |
|
|
T |
11360098 |
aactcataaaccctttctaaggttgaagaagataatgaggtattccaagttgatgagcatcaagaagaagaag |
11360026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 56 - 94
Target Start/End: Complemental strand, 11360680 - 11360642
Alignment:
Q |
56 |
aaacacctgggccatttacaactttggcccactgcacaa |
94 |
Q |
|
|
|||| ||| |||||||||||||||||||||||||||||| |
|
|
T |
11360680 |
aaacgcctaggccatttacaactttggcccactgcacaa |
11360642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 284 - 342
Target Start/End: Original strand, 15507849 - 15507907
Alignment:
Q |
284 |
cagtgttccttcccgacgatctcatagccgaaatcctatcattacttaacgtgaaaacc |
342 |
Q |
|
|
||||||||||||||||||| |||||||||||| ||||||| || |||||| | |||||| |
|
|
T |
15507849 |
cagtgttccttcccgacgagctcatagccgaagtcctatccttccttaacataaaaacc |
15507907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 292 times since January 2019
Visitors: 6714