View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0879_high_3 (Length: 381)
Name: NF0879_high_3
Description: NF0879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0879_high_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 21 - 352
Target Start/End: Original strand, 39662202 - 39662539
Alignment:
Q |
21 |
taatagtttatggtctattaattatttcatttactaggcatatgttaatttgcctgaagtacaatattcattaattcacattaattatttaaaaaataat |
120 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39662202 |
taatagtttatggtctattaattatttcatttactaggcatatgttaatttgcctgaagtacaatattcattaattcacattaattatttaaaaaataat |
39662301 |
T |
 |
Q |
121 |
gaagggtggatctgggaactgggaagtggagtcccctcatcttatctcatctcatgtgaattatagatagtg-------ttactgttattgaaagaccta |
213 |
Q |
|
|
| |||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
39662302 |
ggagggtggatctgggaactgggaagtggagt-ccctcatcttatttcatctcatgtgaattatagatagtgttactgcttactgttattgaaagaccta |
39662400 |
T |
 |
Q |
214 |
gctatgagtagtagctatatggtttgtacagatgataagaaagaatttcacttgtgataggtttttgcactgtttatgcttacttgcttgcccacgtgaa |
313 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39662401 |
gctatgagtagtagctatatggtttgtacagatgataagaaagaatttcacttgtgataggtttttgcactgtttatgcttacttgcttgcccacgtgaa |
39662500 |
T |
 |
Q |
314 |
aacaaacattcctgttcctgcaccggagggagaggagag |
352 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39662501 |
aacaaacattcctgttcctgcaccggagggagaggagag |
39662539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 51; Significance: 4e-20; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 243 - 313
Target Start/End: Complemental strand, 32837845 - 32837775
Alignment:
Q |
243 |
agatgataagaaagaatttcacttgtgataggtttttgcactgtttatgcttacttgcttgcccacgtgaa |
313 |
Q |
|
|
||||| ||| ||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
T |
32837845 |
agatggtaaaaaagaatttcacttgtgataggtttttaaactgtttatgctttcttgcttgcccacgtgaa |
32837775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 272 - 348
Target Start/End: Complemental strand, 49205279 - 49205205
Alignment:
Q |
272 |
aggtttttgcactgtttatgcttacttgcttgcccacgtgaaaacaaacattcctgttcctgcaccggagggagagg |
348 |
Q |
|
|
|||||||| ||||||||||| |||||| |||||||| ||| ||||||||| |||||| ||||||||||||||| |
|
|
T |
49205279 |
aggttttttcactgtttatggttactt--ttgcccaccgaaaaccaaacattcacgttccttcaccggagggagagg |
49205205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 272 - 348
Target Start/End: Original strand, 53965658 - 53965732
Alignment:
Q |
272 |
aggtttttgcactgtttatgcttacttgcttgcccacgtgaaaacaaacattcctgttcctgcaccggagggagagg |
348 |
Q |
|
|
|||||||| ||||||||||| |||||| |||||||| ||| ||||||||| |||||| ||||||||||||||| |
|
|
T |
53965658 |
aggttttttcactgtttatggttactt--ttgcccaccgaaaaccaaacattcacgttccttcaccggagggagagg |
53965732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 961 times since January 2019
Visitors: 6707