View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0879_high_4 (Length: 380)
Name: NF0879_high_4
Description: NF0879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0879_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 308
Target Start/End: Complemental strand, 5569425 - 5569120
Alignment:
Q |
1 |
atcgggttgtcaacctagttggatcgccgttggttcctcttgacgctagtcctctctcctaactatccaaaaaatatatttttcattagacatgtgatga |
100 |
Q |
|
|
|||||||| |||||||||||||| ||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
T |
5569425 |
atcgggttatcaacctagttggaacgccgttggttcctcttgacgctagtcatctctcctgactatccaaaaaatatatttttcaggagacatgtgatga |
5569326 |
T |
 |
Q |
101 |
tttttaaggagtaaacaaccacttttgtctggaagaatgacatgcggtgtcacaataatctctgaatgaattnnnnnnnnnnnnnnnncttcttgaatca |
200 |
Q |
|
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
5569325 |
tttttaaggagtaaacaaccacttttgtctcgaagaatgacatgcggtgtcacaataatctctgaatgaatt--aaaaaaaaataaaacttcttgaatca |
5569228 |
T |
 |
Q |
201 |
cttagttaatcagtttattgacatctattattctactagttgtgatgatgtgtcacattttttgacacatcagctgcatatgtggtaccatttcttcacc |
300 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||| |
|
|
T |
5569227 |
cttagttaatcagtttattgacatctattattctactagttgtgatgatgtgtcacattttttgacaaatcagctgcatatgtggtaccatttattcacc |
5569128 |
T |
 |
Q |
301 |
atattctt |
308 |
Q |
|
|
|||||||| |
|
|
T |
5569127 |
atattctt |
5569120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University